-
Notifications
You must be signed in to change notification settings - Fork 5
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
Showing
13 changed files
with
4,264 additions
and
7 deletions.
There are no files selected for viewing
Large diffs are not rendered by default.
Oops, something went wrong.
Large diffs are not rendered by default.
Oops, something went wrong.
371 changes: 371 additions & 0 deletions
371
fixtures/tests/10075_D_single_TN_pair.argos_1_7_0.input.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,371 @@ | ||
[ | ||
{ | ||
"tumor": { | ||
"ID": "s_C_8VK0V7_R001_d", | ||
"CN": "MSKCC", | ||
"LB": "10075_D_5_1_1_1", | ||
"PL": "Illumina", | ||
"PU": [ | ||
"HFTCNBBXY_GTATTGGC-TTGTCGGT" | ||
], | ||
"R1": [ | ||
{ | ||
"class": "File", | ||
"location": "juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0439_BHFTCNBBXY/Project_10075_D/Sample_SK_MEL_1091A_T_IGO_10075_D_5/SK_MEL_1091A_T_IGO_10075_D_5_S80_R1_001.fastq.gz" | ||
} | ||
], | ||
"R2": [ | ||
{ | ||
"class": "File", | ||
"location": "juno:///ifs/archive/GCL/hiseq/FASTQ/PITT_0439_BHFTCNBBXY/Project_10075_D/Sample_SK_MEL_1091A_T_IGO_10075_D_5/SK_MEL_1091A_T_IGO_10075_D_5_S80_R2_001.fastq.gz" | ||
} | ||
], | ||
"zR1": [], | ||
"zR2": [], | ||
"bam": [], | ||
"RG_ID": [ | ||
"s_C_8VK0V7_R001_d_HFTCNBBXY_GTATTGGC-TTGTCGGT" | ||
], | ||
"adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", | ||
"adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", | ||
"bwa_output": "s_C_8VK0V7_R001_d.bam", | ||
"request_id": "10075_D", | ||
"specimen_type": "Local Recurrence" | ||
}, | ||
"normal": { | ||
"ID": "s_C_8VK0V7_N001_d", | ||
"CN": "MSKCC", | ||
"LB": "10075_D_3", | ||
"PL": "Illumina", | ||
"PU": [ | ||
"HCYYWBBXY" | ||
], | ||
"R1": [ | ||
{ | ||
"class": "File", | ||
"location": "juno:///ifs/archive/GCL/hiseq/FASTQ/JAX_0397_BHCYYWBBXY/Project_10075_D/Sample_JW_MEL_007_NORM_IGO_10075_D_3/JW_MEL_007_NORM_IGO_10075_D_3_S15_R1_001.fastq.gz" | ||
} | ||
], | ||
"R2": [ | ||
{ | ||
"class": "File", | ||
"location": "juno:///ifs/archive/GCL/hiseq/FASTQ/JAX_0397_BHCYYWBBXY/Project_10075_D/Sample_JW_MEL_007_NORM_IGO_10075_D_3/JW_MEL_007_NORM_IGO_10075_D_3_S15_R2_001.fastq.gz" | ||
} | ||
], | ||
"zR1": [], | ||
"zR2": [], | ||
"bam": [], | ||
"RG_ID": [ | ||
"s_C_8VK0V7_N001_d_HCYYWBBXY" | ||
], | ||
"adapter": "AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGCCGTCTTCTGCTTG", | ||
"adapter2": "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT", | ||
"bwa_output": "s_C_8VK0V7_N001_d.bam", | ||
"request_id": "10075_D", | ||
"specimen_type": "Normal" | ||
}, | ||
"assay": "IMPACT468_BAITS", | ||
"pi": "John Smith", | ||
"pi_email": "[email protected]", | ||
"patient_id": "C-8VK0V7", | ||
"curated_bams": [ | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006708_N001_d.Group9.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006709_N001_d.Group11.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006710_N001_d.Group5.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006711_N001_d.Group7.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006713_N001_d.Group10.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006714_N001_d.Group8.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006715_N001_d.Group6.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006716_N001_d.Group4.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006717_N001_d.Group3.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_006718_N001_d.Group1.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_09TAFV_N001_d.Group20.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_1FPU8J_N001_d.Group10.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_29F7HE_N001_d.Group17.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_2J273K_N001_d.Group22.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_32WX55_N001_d.Group17.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_3WFCFP_N001_d.Group24.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_4XFY8V_N001_d.Group2.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_7XDAJW_N001_d.Group15.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_96X4FW_N001_d.Group13.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_A8N9WX_N001_d.Group12.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_CTR0E9_N001_d.Group25.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_DJE4C0_N001_d.Group8.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_FDR1YC_N001_d.Group27.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_FWK8C0_N001_d.Group8.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_HRE3UJ_N001_d.Group9.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_JFM1K9_N001_d.Group3.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_JWYL4J_N001_d.Group19.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_KAT85C_N001_d.Group15.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_LC80PX_N001_d.Group7.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_LNNV52_N001_d.Group26.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_MWF8PH_N001_d.Group6.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_NJHH88_N001_d.Group16.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_NR3W32_N001_d.Group21.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_P10A8A_N001_d.Group29.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_U53DXH_N001_d.Group1.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_U8A7CR_N001_d.Group14.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_VXC8TK_N001_d.Group24.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_W0TXP0_N001_d.Group22.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_WWTK32_N001_d.Group18.rg.md.abra.printreads.bam" | ||
}, | ||
{ | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/curated_bams/IMPACT468_b37/s_C_XXC7N6_N001_d.Group12.rg.md.abra.printreads.bam" | ||
} | ||
], | ||
"hapmap": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/request_files/hapmap/hapmap_3.3.b37.vcf" | ||
}, | ||
"dbsnp": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/request_files/dbsnp/dbsnp_138.b37.excluding_sites_after_129.vcf" | ||
}, | ||
"indels_1000g": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/request_files/indels_1000g/Mills_and_1000G_gold_standard.indels.b37.vcf" | ||
}, | ||
"snps_1000g": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/request_files/snps_1000g/1000G_phase1.snps.high_confidence.b37.vcf" | ||
}, | ||
"cosmic": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/request_files/cosmic/CosmicCodingMuts_v67_b37_20131024__NDS.vcf" | ||
}, | ||
"exac_filter": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/vep/cache/ExAC_nonTCGA.r0.3.1.sites.vep.vcf.gz" | ||
}, | ||
"ref_fasta": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomes/GRCh37/fasta/b37.fasta" | ||
}, | ||
"mouse_fasta": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomes/GRCm38/GRCm38.fasta" | ||
}, | ||
"db_files": { | ||
"refseq": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/request_files/refseq/refGene_b37.sorted.txt" | ||
}, | ||
"vep_data": "/var/cache", | ||
"hotspot_list": "/usr/bin/ngs-filters/data/hotspot-list-union-v1-v2.txt", | ||
"hotspot_list_maf": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/qc_resources/hotspot-list-union-v1-v2.maf" | ||
}, | ||
"delly_exclude": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomes/GRCh37/delly/human.hg19.excl.tsv" | ||
}, | ||
"hotspot_vcf": "/usr/bin/basicfiltering/data/hotspot-list-union-v1-v2.vcf", | ||
"facets_snps": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomes/GRCh37/facets_snps/dbsnp_137.b37__RmDupsClean__plusPseudo50__DROP_SORT.vcf.gz" | ||
}, | ||
"custom_enst": "/usr/bin/vcf2maf/data/isoform_overrides_at_mskcc", | ||
"vep_path": "/usr/bin/vep", | ||
"conpair_markers": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.txt", | ||
"conpair_markers_bed": "/usr/bin/conpair/data/markers/GRCh37.autosomes.phase3_shapeit2_mvncall_integrated.20130502.SNV.genotype.sselect_v4_MAF_0.4_LD_0.8.bed", | ||
"bait_intervals": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomic_resources/targets/IMPACT468/b37/picard_baits.interval_list" | ||
}, | ||
"target_intervals": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomic_resources/targets/IMPACT468/b37/picard_targets.interval_list" | ||
}, | ||
"fp_intervals": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomic_resources/targets/IMPACT468/b37/FP_tiling_intervals.list" | ||
}, | ||
"fp_genotypes": { | ||
"class": "File", | ||
"location": "juno:///rtsess01/compute/juno/bic/juno/work/ci/resources/genomic_resources/targets/IMPACT468/b37/FP_tiling_genotypes.txt" | ||
} | ||
}, | ||
"runparams": { | ||
"abra_scratch": "/scratch", | ||
"abra_ram_min": 84000, | ||
"genome": "GRCh37", | ||
"intervals": [ | ||
"1", | ||
"2", | ||
"3", | ||
"4", | ||
"5", | ||
"6", | ||
"7", | ||
"8", | ||
"9", | ||
"10", | ||
"11", | ||
"12", | ||
"13", | ||
"14", | ||
"15", | ||
"16", | ||
"17", | ||
"18", | ||
"19", | ||
"20", | ||
"21", | ||
"22", | ||
"X", | ||
"Y", | ||
"MT" | ||
], | ||
"mutect_dcov": 50000, | ||
"mutect_rf": [ | ||
"BadCigar" | ||
], | ||
"num_cpu_threads_per_data_thread": 6, | ||
"covariates": [ | ||
"CycleCovariate", | ||
"ContextCovariate", | ||
"ReadGroupCovariate", | ||
"QualityScoreCovariate" | ||
], | ||
"emit_original_quals": true, | ||
"num_threads": 10, | ||
"assay": "IMPACT468_BAITS", | ||
"tmp_dir": "/scratch", | ||
"project_prefix": "10075_D", | ||
"opt_dup_pix_dist": "2500", | ||
"delly_type": [ | ||
"DUP", | ||
"DEL", | ||
"INV", | ||
"INS", | ||
"BND" | ||
], | ||
"facets_cval": 50, | ||
"facets_pcval": 100, | ||
"complex_nn": 0.2, | ||
"complex_tn": 0.5, | ||
"scripts_bin": "/usr/bin", | ||
"gatk_jar_path": "/usr/bin/gatk.jar", | ||
"pi": "John Smith", | ||
"pi_email": "[email protected]" | ||
} | ||
} | ||
] |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
from .argos_operator import ArgosOperator |
Oops, something went wrong.