phac-nml · DarianHole · Mar 22, 2024 · Mar 20, 2024 · Mar 20, 2024 · Mar 21, 2024
diff --git a/.nf-core.yml b/.nf-core.yml
@@ -6,7 +6,11 @@ lint:
   - .github/workflows/awsfulltest.yml
   files_unchanged:
   - CODE_OF_CONDUCT.md
+  pipeline_name_conventions: False
+  actions_awsfulltest: False
   nextflow_config:
-  - manifest.name
-repository_type: pipeline
+    - custom_config
+    - manifest.name
+    - manifest.homePage
 
+repository_type: pipeline
diff --git a/CHANGELOG.md b/CHANGELOG.md
@@ -3,14 +3,10 @@
 The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/)
 and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html).
 
-## v1.0.0 - [date]
+## v1.0.0 - [2024-03-22]
 
 Initial release of `phac-nml/viralassembly`, created from combining the [nf-core](https://nf-co.re/) template with the artic steps.
 
 ### `Added`
-
-### `Fixed`
-
-### `Dependencies`
-
-### `Deprecated`
+- All initial pipeline features and logic
+- All initial docs and images
diff --git a/README.md b/README.md
diff --git a/assets/multiqc_config_overall.yaml b/assets/multiqc_config_overall.yaml
@@ -20,10 +20,15 @@ run_modules:
   - samtools
   - qualimap
   - bcftools
+  - nanostat
   - snpeff
 
 # Order for reports
 module_order:
+  - nanostat:
+    name: Nanostat filtered fastq statistics
+    path_filters:
+      - "*.nanostat.txt"
   - samtools
   - qualimap
   - bcftools
@@ -178,7 +183,9 @@ custom_data:
       ]
 
 # Extensions to clean from names
-# extra_fn_clean_exts:
+extra_fn_clean_exts:
+  - '.nanostat'
+  - '.ann'
 
 # Search Pathes
 sp:

diff --git a/assets/multiqc_config_sample.yaml b/assets/multiqc_config_sample.yaml
@@ -16,10 +16,15 @@ skip_generalstats: true
 # Modules/tools supported that we only want to grab
 run_modules:
   - custom_content
+  - nanostat
   - qualimap
 
 # Order for reports
 module_order:
+  - nanostat:
+    name: Nanostat filtered fastq statistics
+    path_filters:
+      - "*.nanostat.txt"
   - qualimap
 
 report_section_order:
@@ -250,7 +255,8 @@ custom_data:
         scale: "Purples"
 
 # Extensions to clean from names
-# extra_fn_clean_exts:
+extra_fn_clean_exts:
+  - '.nanostat'
 
 # Search Pathes
 sp:

diff --git a/assets/rmarkdown-reports/reportDashboard.Rmd b/assets/rmarkdown-reports/reportDashboard.Rmd
@@ -1,5 +1,5 @@
 ---
-title: "NML Sequencing Run Report"
+title: "Sequencing Run Report"
 output:
   flexdashboard::flex_dashboard:
     orientation: rows

diff --git a/conf/nml.config b/conf/nml.config
@@ -2,7 +2,6 @@
 env {
     OPENBLAS_NUM_THREADS = 1
 }
-
 params {
     // Config params
     config_profile_name = "nml"
@@ -14,7 +13,6 @@ params {
     max_retries = 3
     max_jobs = 100
 }
-
 process {
     // Base process
     executor    = "slurm"

diff --git a/conf/test.config b/conf/test.config
@@ -24,5 +24,5 @@ params {
 
     // Args
     variant_caller = "clair3"
-    reference_no_scheme = "$projectDir/.github/test-data/nanopore/MN908947.3.reference.fasta"
+    reference = "$projectDir/.github/test-data/nanopore/MN908947.3.reference.fasta"
 }
diff --git a/conf/test_full.config b/conf/test_full.config
@@ -26,4 +26,6 @@ params {
     variant_caller = "medaka"
     medaka_model = "r1041_e82_400bps_sup_v4.3.0"
     metadata = "$projectDir/.github/test-data/nanopore/metadata.tsv"
+    scheme = 'nCoV-2019'
+    scheme_version = 'V5.3.2'
 }
diff --git a/docs/README.md b/docs/README.md
@@ -2,7 +2,9 @@
 
 The phac-nml/viralassembly documentation is split into the following pages:
 
-- [Usage](usage.md)
+- [Usage](./usage.md)
   - An overview of how the pipeline works, how to run it and a description of all of the different command-line flags.
-- [Output](output.md)
+- [Example Commands](./example_commands.md)
+  - Different command examples
+- [Output](./output.md)
   - An overview of the different results produced by the pipeline and how to interpret them.
diff --git a/docs/example_commands.md b/docs/example_commands.md
@@ -0,0 +1,94 @@
+# phac-nml/viralassembly: Example Commands
+A variety of example commands using different parameter options to display how to use each
+
+## Amplicon
+
+### Clair3
+Clair3 with a local model, local scheme, fastq directory, conda, and the custom report output
+
+```bash
+nextflow run phac-nml/viralassembly \
+  -profile conda \
+  --fastq_pass FASTQ_PASS/ \
+  --variant_caller 'clair3' \
+  --clair3_model ./r1041_e82_400bps_sup_v420 \
+  --local_scheme ./primer_schemes \
+  --scheme 'hCMV' \
+  --scheme_version 'V1' \
+  --custom_report \
+  --outdir ./results
+```
+
+### Medaka
+Minimal input medaka with conda, an input csv file for data, and the nCoV-2019 scheme
+
+```bash
+nextflow run phac-nml/viralassembly \
+  -profile conda \
+  --input INPUT.csv \
+  --variant_caller 'medaka' \
+  --scheme 'nCoV-2019' \
+  --scheme_version 'V5.3.2' \
+  --outdir ./results
+```
+
+### Nanopolish
+Nanopolish run using singularity and the base artic command line tool (instead of the default nextflow implementation)
+
+```bash
+nextflow run phac-nml/viralassembly \
+  -profile singularity \
+  --input INPUT.csv \
+  --fast5_pass FAST5_PASS/ \
+  --sequencing_summart SEQ_SUM.txt \
+  --variant_caller 'nanopolish' \
+  --scheme 'nCoV-2019' \
+  --scheme_version 'V5.3.2' \
+  --use_artic_tool \
+  --outdir ./results
+```
+
+--------------------------
+
+## Non-Amplicon
+
+### Clair3
+Minimal clair3 with docker using a fastq input directory along wth a gff3 reference file for SnpEff
+
+```bash
+nextflow run phac-nml/viralassembly \
+  -profile docker \
+  --fastq_pass FASTQ_PASS/ \
+  --variant_caller 'clair3' \
+  --reference ./REFERENCE.fa \
+  --gff ./REFERENCE.gff
+```
+
+### Medaka
+Medaka with conda skipping QC and SnpEff
+
+```bash
+nextflow run phac-nml/viralassembly \
+  -profile conda \
+  --input INPUT.csv \
+  --variant_caller 'medaka' \
+  --reference ./REFERENCE.fa \
+  --skip_qc \
+  --skip_snpeff
+```
+
+### Nanopolish
+Nanopolish running with conda, filtering the read lengths to be shorter, and creating a custom report
+
+```bash
+nextflow run phac-nml/viralassembly \
+  -profile conda \
+  --input INPUT.csv \
+  --fast5_pass FAST5_PASS/ \
+  --sequencing_summart SEQ_SUM.txt \
+  --variant_caller 'nanopolish' \
+  --reference ./REFERENCE.fa \
+  --min_length 100 \
+  --max_length 600 \
+  --outdir ./results
+```
diff --git a/docs/example_files/inputs/example_custom_scheme/virus/V1-custom/custom.reference.fasta b/docs/example_files/inputs/example_custom_scheme/virus/V1-custom/custom.reference.fasta
@@ -0,0 +1,9 @@
+>Custom.1
+ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT
+GTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACT
+CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATC
+TTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT
+CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAAC
+CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATC
+TTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT
+ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT
diff --git a/docs/example_files/inputs/example_custom_scheme/virus/V1-custom/custom.scheme.bed b/docs/example_files/inputs/example_custom_scheme/virus/V1-custom/custom.scheme.bed
@@ -0,0 +1,4 @@
+Custom.1	10	34	custom_1_LEFT	1	+
+Custom.1	300	320	custom_1_RIGHT	1	-
+Custom.1	220	246	custom_2_LEFT	2	+
+Custom.1	440	460	custom_2_RIGHT	2	-
diff --git a/docs/example_files/inputs/input.csv b/docs/example_files/inputs/input.csv
@@ -0,0 +1,11 @@
+sample,reads
+negative-ctrl-1,barcode11
+run-ntc-1,barcode94
+pos-ctrl-1,barcode95
+cov-1,barcode5
+cov-2,barcode01
+cov-3,barcode12
+cov-4,barcode19
+cov-5,barcode40
+cov-6,barcode61
+cov-7,barcode75
diff --git a/docs/example_files/inputs/metadata.tsv b/docs/example_files/inputs/metadata.tsv
@@ -0,0 +1,11 @@
+sample	barcode	run	other
+negative-ctrl-1	11	example-run	additional_info
+run-ntc-1	94	example-run	additional_info
+pos-ctrl-1	95	example-run	additional_info
+cov-1	5	example-run	additional_info
+cov-2	1	example-run	additional_info
+cov-3	12	example-run	additional_info
+cov-4	19	example-run	additional_info
+cov-5	40	example-run	additional_info
+cov-6	61	example-run	additional_info
+cov-7	75	example-run	additional_info
diff --git a/docs/images/amplicons_custom.png b/docs/images/amplicons_custom.png
diff --git a/docs/images/bcftools_mqc.png b/docs/images/bcftools_mqc.png
diff --git a/docs/images/completeness_mqc.png b/docs/images/completeness_mqc.png
diff --git a/docs/images/nanostat_mqc.png b/docs/images/nanostat_mqc.png
diff --git a/docs/images/qc_mqc.png b/docs/images/qc_mqc.png
diff --git a/docs/images/qualimap_mqc.png b/docs/images/qualimap_mqc.png
diff --git a/docs/images/run_summary_custom.png b/docs/images/run_summary_custom.png
diff --git a/docs/images/sample_custom.png b/docs/images/sample_custom.png
diff --git a/docs/images/sample_mqc_mqc.png b/docs/images/sample_mqc_mqc.png
diff --git a/docs/images/samtools_mqc.png b/docs/images/samtools_mqc.png
diff --git a/docs/images/snpeff_mqc.png b/docs/images/snpeff_mqc.png
diff --git a/docs/images/variation_mqc.png b/docs/images/variation_mqc.png