Merge pull request #34 from mmcguffi/fix

Fix

.github/workflows/conda-test.yml

@@ -0,0 +1,44 @@
+name: Conda test
+
+on:
+  pull_request:
+    branches:
+      - master
+  workflow_dispatch:
+  schedule:
+    - cron: '0 0 1 * *'
+
+
+jobs:
+  build:
+    runs-on: ${{ matrix.os }}
+    strategy:
+      matrix:
+        os: [ubuntu-latest, macos-latest]
+      max-parallel: 5
+
+    steps:
+    - uses: actions/checkout@v3
+    - name: setup miniconda
+      uses: conda-incubator/[email protected]
+      with:
+        environment-file: environment.yml
+        activate-environment: plannotate
+
+    - name: get conda info
+      shell: bash -l {0}
+      run: |
+          conda info
+          conda list
+
+    - name: get plannotate dbs
+      shell: bash -l {0}
+      run: |
+        python -c "from plannotate.resources import download_databases; download_databases()"
+
+    - name: pytest
+      shell: bash -l {0}    
+      run: |
+        pip install pytest
+        pytest --version
+        pytest

.github/workflows/python-package-conda.yml

@@ -21,11 +21,14 @@ jobs:
         generate-run-shell: true
         environment-file: environment.yml
         cache-downloads: true
+
     - run: pip install pytest
       shell: micromamba-shell {0}
+
     - run: |
         python -c "from plannotate.resources import download_databases; download_databases()"
       shell: micromamba-shell {0}
+    
     - run: |
         pytest --version
         pytest

.streamlit/config.toml

@@ -147,38 +147,3 @@ showfileUploaderEncoding = "True"
 # Default: "True"
 showPyplotGlobalUse = "True"
 
-
-[s3]
-
-# Name of the AWS S3 bucket to save apps.
-# Default: (unset)
-#bucket =
-
-# URL root for external view of Streamlit apps.
-# Default: (unset)
-#url =
-
-# Access key to write to the S3 bucket.
-# Leave unset if you want to use an AWS profile.
-# Default: (unset)
-#accessKeyId =
-
-# Secret access key to write to the S3 bucket.
-# Leave unset if you want to use an AWS profile.
-# Default: (unset)
-#secretAccessKey =
-
-# The "subdirectory" within the S3 bucket where to save apps.
-# S3 calls paths "keys" which is why the keyPrefix is like a subdirectory. Use "" to mean the root directory.
-# Default: ""
-keyPrefix = ""
-
-# AWS region where the bucket is located, e.g. "us-west-2".
-# Default: (unset)
-#region =
-
-# AWS credentials profile to use.
-# Leave unset to use your default profile.
-# Default: (unset)
-#profile =
-

environment.yml

@@ -15,6 +15,6 @@ dependencies:
   - ripgrep>=13.0.0
   - tabulate>=0.8.9
   - trnascan-se>=2.0.7
-  - streamlit=1.8.*
+  - streamlit=1.8.1
   - altair=4.2.*
   - bokeh=2.4.1

plannotate/annotate.py

@@ -200,7 +200,7 @@ def clean(inDf):
             columnSlice = list(range(0, qend + 1)) + list(range(qstart, end))
 
         # only the rows that are in the columns of hit
-        rowSlice = (seqSpace[columnSlice] == kind).any(axis = 1)
+        rowSlice = (seqSpace[columnSlice] == kind).any(axis=1)
         toDrop = toDrop | set(
             seqSpace[rowSlice].loc[i + 1 :].index
         )  # add the indexs below the current to the drop-set
@@ -306,7 +306,19 @@ def calc_priority_mod(d, s, e):
     return feat_desc
 
 
-@st.cache(
+def cache(*args, **kwargs):
+    def decorator(func):
+        try:
+            __IPYTHON__  # type: ignore
+            # We are in a Jupyter environment, so don't apply st.cache
+            return func
+        except NameError:
+            return st.cache(func, *args, **kwargs)
+
+    return decorator
+
+
+@cache(
     hash_funcs={pd.DataFrame: lambda _: None},
     suppress_st_warning=True,
     max_entries=10,

plannotate/bokeh_plot.py

@@ -152,7 +152,6 @@ def calc_level(inDf):
     )
 
     calculated_levels = pd.DataFrame(columns=["index", "s", "e", "level"])
-    # calculated_levels = [pd.DataFrame(columns=["index", "s", "e", "level"])]
     for index in levels.index:
         s = levels.loc[index]["qstart"]
         e = levels.loc[index]["qend"]
@@ -183,6 +182,8 @@ def calc_level(inDf):
                 ),
             ]
         )
+
+    calculated_levels = calculated_levels.set_index("index")
     inDf = inDf.join(calculated_levels[["level"]])
 
     ################################################################

plannotate/data/data/databases.yml

@@ -22,6 +22,10 @@ fpbase:
     - --gapextend 1
     - --algo ctg
     - --id 75
+    - --max-hsps 10
+    - --culling-overlap 200
+    - --seed-cut .001
+    - --comp-based-stats 0
   details:
     default_type: CDS
     location: Default
@@ -40,6 +44,10 @@ swissprot:
     - --gapextend 1
     - --algo ctg
     - --id 50
+    - --max-hsps 10
+    - --culling-overlap 200
+    - --seed-cut .001
+    - --comp-based-stats 0
   details:
     default_type: CDS
     location: Default

plannotate/pLannotate.py

@@ -97,6 +97,7 @@ def main_setupdb():
 @click.option(
     "--input",
     "-i",
+    required=True,
     help=f"location of a FASTA or GBK file",
 )
 @click.option(

tests/manual_jupyter_test.ipynb

@@ -0,0 +1,54 @@
+{
+ "cells": [
+  {
+   "cell_type": "code",
+   "execution_count": null,
+   "metadata": {},
+   "outputs": [],
+   "source": [
+    "from plannotate.annotate import annotate\n",
+    "from plannotate.bokeh_plot import get_bokeh\n",
+    "from plannotate.resources import get_seq_record\n",
+    "from bokeh.io import show\n",
+    "\n",
+    "# for inline plotting in jupyter\n",
+    "from bokeh.resources import INLINE\n",
+    "import bokeh.io\n",
+    "bokeh.io.output_notebook(INLINE)\n",
+    "\n",
+    "seq = \"tgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggtctcaatccacgggtacgggtatggagaaacagtagagagttgcgataaaaagcgtcaggtagtatccgctaatcttatggataaaaatgctatggcatagcaaagtgtgacgccgtgcaaataatcaatgtggacttttctgccgtgattatagacacttttgttacgcgtttttgtcatggctttggtcccgctttgttacagaatgcttttaataagcggggttaccggtttggttagcgagaagagccagtaaaagacgcagtgacggcaatgtctgatgcaatatggacaattggtttcttgtaatcgttaatccgcaaataacgtaaaaacccgcttcggcgggtttttttatggggggagtttagggaaagagcatttgtcatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcgg\"\n",
+    "\n",
+    "# get pandas df of annotations\n",
+    "hits = annotate(seq, is_detailed = True, linear= True)\n",
+    "\n",
+    "# get biopython SeqRecord object\n",
+    "seq_record = get_seq_record(hits, seq)\n",
+    "\n",
+    "# show plot\n",
+    "show(get_bokeh(hits, linear=True))"
+   ]
+  }
+ ],
+ "metadata": {
+  "kernelspec": {
+   "display_name": "Python 3",
+   "language": "python",
+   "name": "python3"
+  },
+  "language_info": {
+   "codemirror_mode": {
+    "name": "ipython",
+    "version": 3
+   },
+   "file_extension": ".py",
+   "mimetype": "text/x-python",
+   "name": "python",
+   "nbconvert_exporter": "python",
+   "pygments_lexer": "ipython3",
+   "version": "3.10.12"
+  },
+  "orig_nbformat": 4
+ },
+ "nbformat": 4,
+ "nbformat_minor": 2
+}

tests/test_units.py

@@ -7,8 +7,10 @@
 import pytest
 from Bio import SeqIO
 from Bio.SeqRecord import SeqRecord
+from click.testing import CliRunner
 
 from plannotate import annotate, bokeh_plot, resources, streamlit_app
+from plannotate.pLannotate import main_streamlit, main_batch
 
 with open("./tests/test_data/RRNB_fragment.txt") as f:
     RRNB = f.read()
@@ -149,10 +151,30 @@ def test_streamlit_app():
     """this component is hard to test"""
     streamlit_app.run_streamlit(["--yaml-file", resources.get_yaml_path()])
 
+# # runs indefinitely
+# def test_streamlit():
+#     runner = CliRunner()
+#     result = runner.invoke(main_streamlit)
+#     assert result.exit_code == 0
+
+
+def test_batch():
+    runner = CliRunner()
+    result = runner.invoke(main_batch)
+    assert result.exit_code == 2  # proper exit code for no args
+
+
+def test_batch_help():
+    runner = CliRunner()
+    result = runner.invoke(main_batch, ["--help"])
+    assert result.exit_code == 0
+
 
 def test_annotate():
     hits = annotate.annotate(RRNB)
     assert hits.iloc[0]["sseqid"] == "rrnB_T1_terminator"
+    hits = annotate.annotate(RRNB, linear=True)
+    assert hits.iloc[0]["sseqid"] == "rrnB_T1_terminator"
 
 
 ####