This repository is the original implementation of sslRNAD: The Single Stem Loop sRNA Designer (WebSever: ssl-sRNA de novo designer).
sslRNAD is a program that allows users to design single stem loop sRNAs (ssl-sRNA) from scratch, to repress the expression of the gene of interest (target gene). This package contains an ssl-sRNA scoring function and related scripts to design automatically ssl-sRNA with predefined single stem loop structure and tunable regulatory activities.
Numerous ssl-sRNAs can be designed by sslRNAD for a selected gene. sslRNAD also accepts batch target genes input (DNA sequence in fasta-format). In this situation, one ssl-sRNA with strong activity will be designed for each target gene. For each ssl-sRNA, sslRNAD design simultaneously two pairs of primers, which containing the DNA sequences of the ssl-sRNA, the interfaced promoter (customized) and regions homologous to the expression backbone (customized vector/plasmid). With the designed primers, users can do one-pot PCR to construct the expression vector of the ssl-sRNA. A simple demo is provided.
Ubuntu 18.04
Python v3.6.9 or above
ViennaRNA v2.4.17 or above
NUPACK v4.0.0.23 or above
biopython
openpyxl
getopt
primer3-py
NUPACK
subprocess
random
re
This version of the software has been tested on : Python v3.6.9 and PyCharm Community Edition 2020.2.3 is used for this to run the python scripts.
The original source code is in the methods folder, and you can run sslRNAD on cmd directly using these scripts. No additional installation is needed if aforementioned dependencies are satisfied. The detail usages are demonstrated in the Demo section. Make sure the ViennaRNA is set to permanent global environment variables and the methods folder is in the same path of the demo scripts.
Simple demos are provided /sslRNAD/Demo
.
The batch_input_test.fasta contains a set of genes which can be imported to sslRNAD to create a ssl-sRNA library. The flank_sequence_test.fasta contains the flank sequences of the ssl-sRNA-insertion-site on the selected vector and the selected interfaced promoter sequence, which are required for the design of primers. Experimental construction of the ssl-sRNA expression vectors can be performed via one-pot PCR with the designed primers and the selected vector (as template).
The results of ssl-sRNA library and related primers are in the Demo_result.xlsx. Please note different results will be returned from every running of the programs, because ssl-sRNA sequences are generated randomly.
Design of ssl-sRNA with desired activity for a single gene could be achieved by directly input the target gene sequence, repression level and the number of required ssl-sRNA in cmd.
cd ~/Demo/
#As for constructing a library of target genes, an excel file containing the custom *ssl*-sRNAs and related primers will be generated.
#Usage: python3 Demo_batch_design.py -s <flank_sequence.fasta> -i <batch_input_target_genes.fasta> -o <output_file_name>
$ python3 Demo_batch_design.py -s flank_sequence_test.fasta -i batch_input_test.fasta -i batch_input_test.fasta -o Demo_results
#As for creating *ssl*-sRNA with desired activity for a single gene, *ssl*-sRNA candidates will be directily print on the screen.
#Usage: python3 Programmable_strength_sRNA.py -i <Target_24_nt_sequence> -r <Repression_level> -t <Trials>
$ python3 Programmable_strength_sRNA.py -i ATGCAGTCATCGTAGCAGTCAGTC -r S -t 5
The demo results are as follows.
sslRNAD is freely available at http://www.kangzlab.cn/ as ssl-sRNA de novo designer.