generated from snakemake-workflows/snakemake-workflow-template
-
Notifications
You must be signed in to change notification settings - Fork 0
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
1 parent
e9a8e72
commit 4da7533
Showing
8 changed files
with
121 additions
and
68 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,5 +1,15 @@ | ||
results/** | ||
resources/** | ||
logs/** | ||
slurm-logs/ | ||
.snakemake | ||
.snakemake/** | ||
|
||
*.dot | ||
*.png | ||
*.csv | ||
*.tsv | ||
*.txt | ||
|
||
snakemake-env/ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,6 +1,5 @@ | ||
data: | ||
reads_dir: "/data/biol-silvereye/norfolk_wgs/arbor" | ||
samples: "/data/biol-silvereye/ball6625/norfolk-pipeline/samples.txt" | ||
reference-genome: "/data/biol-silvereye/sjoh4959/ref_genome/Zlat_2_Tgutt_ZW.fasta" | ||
adapter1: "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA" | ||
adapter2: "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" | ||
reads_dir: "/data/biol-silvereye/norfolk_wgs/arbor" | ||
samples: "/data/biol-silvereye/ball6625/norfolk-pipeline/samples.txt" | ||
reference-genome: "/data/biol-silvereye/sjoh4959/ref_genome/Zlat_2_Tgutt_ZW.fasta" | ||
adapter1: "AGATCGGAAGAGCACACGTCTGAACTCCAGTCA" | ||
adapter2: "AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,4 +1,44 @@ | ||
# Main entrypoint of the workflow. | ||
# Please follow the best practices: | ||
# https://snakemake.readthedocs.io/en/stable/snakefiles/best_practices.html, | ||
# in particular regarding the standardized folder structure mentioned there. | ||
# ================================================================================================= | ||
# Setup | ||
# ================================================================================================= | ||
|
||
# Packages | ||
import pandas as pd | ||
import os | ||
|
||
# Point to config file | ||
configfile: "config/config.yaml" | ||
|
||
# Read in sample names | ||
with open(config["samples"]) as f: | ||
SAMPLES = [line.strip() for line in f] | ||
|
||
# State reads | ||
READS = ['1', '2'] | ||
|
||
# ================================================================================================= | ||
# Default "All" Target Rule | ||
# ================================================================================================= | ||
|
||
# This rule requests that other rules be run. | ||
|
||
rule all: | ||
input: | ||
expand("results/fastqc_initial/{sample}_R{read}_fastqc.html", sample=SAMPLES, read=READS), | ||
expand("results/trimmed/{sample}.collapsed.trimmed.fastq.gz", sample=SAMPLES), | ||
expand("results/fastqc_post_trim/{sample}_collapsed_fastqc.html", sample=SAMPLES), | ||
expand("results/dedup/{sample}.bam", sample=SAMPLES), | ||
expand("results/mapdamage/{sample}/Runtime_log.txt", sample=SAMPLES), | ||
expand("results/dedup/{sample}.stats", sample=SAMPLES), | ||
expand("results/dedup/{sample}.depth", sample=SAMPLES) | ||
|
||
localrules: | ||
all | ||
|
||
# ================================================================================================= | ||
# Rule Modules | ||
# ================================================================================================= | ||
|
||
include: "rules/clean.smk" | ||
include: "rules/map.smk" | ||
include: "rules/damage.smk" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters