From ce90d5380c88f31f284839b2509f6ac16683ac0a Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Wed, 16 Oct 2024 14:49:56 -0400
Subject: [PATCH 01/91] add peak calling

---
 pipelines/skylab/atac/atac.wdl | 26 ++++++++++++++++++++------
 1 file changed, 20 insertions(+), 6 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 8918a8d8ad..2516b8088b 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -537,6 +537,7 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
+    peakcalling_bool = true
 
     # calculate chrom size dictionary based on text file
     chrom_size_dict={}
@@ -553,10 +554,10 @@ task CreateFragmentFile {
     import csv
 
     # extract CB or BB (if preindex is true) tag from bam file to create fragment file
-    if preindex == "true":
-      data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="BB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
-    elif preindex == "false":
-      data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="CB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
+    if preindex:
+        data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="BB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
+    else:
+        data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="CB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
     
     # Add NHashID to metrics 
     nhash_ID_value = "XXX"
@@ -575,7 +576,6 @@ task CreateFragmentFile {
     with open(csv_file_path, mode='w', newline='') as file:
         writer = csv.writer(file)
         writer.writerows(flattened_data)  # Write data
-
     print(f"Dictionary successfully written to {csv_file_path}")
 
     atac_data = ad.read_h5ad("temp_metrics.h5ad")
@@ -583,9 +583,23 @@ task CreateFragmentFile {
     atac_data.uns['NHashID'] = atac_nhash_id
     # calculate tsse metrics
     snap.metrics.tsse(atac_data, atac_gtf)
-    # Write new atac file
     atac_data.write_h5ad("~{bam_base_name}.metrics.h5ad")
 
+    # peak calling? https://kzhang.org/SnapATAC2/tutorials/diff.html#Peak-calling-at-the-cluster-level
+    if peakcalling_bool:
+        print("Peak calling using MACS3")
+        snap.tl.macs3(atac_data) # were not including cell type?
+        print("test")
+        print(data.uns['macs3'])
+
+        print("Writing peak files")
+        for k, peaks in data.uns['macs3'].items():
+            peaks.to_csv(f'{k}.NarrowPeak', sep='\t', header=False, index=False)
+        ls 
+    
+    # Write atac file
+    print("Writing h5ad file")
+    atac_data.write_h5ad("~{bam_base_name}.peaks.h5ad")
     CODE
   >>>
 

From 82c5c454daed51a1a8c748b61b78c54b3201cea1 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Wed, 16 Oct 2024 15:32:09 -0400
Subject: [PATCH 02/91] added output for peaks

---
 pipelines/skylab/atac/atac.wdl | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 2516b8088b..61f38361d6 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -598,7 +598,7 @@ task CreateFragmentFile {
         ls 
     
     # Write atac file
-    print("Writing h5ad file")
+    print("Writing h5ad file with peaks")
     atac_data.write_h5ad("~{bam_base_name}.peaks.h5ad")
     CODE
   >>>
@@ -614,6 +614,7 @@ task CreateFragmentFile {
   output {
     File fragment_file = "~{bam_base_name}.fragments.tsv"
     File Snap_metrics = "~{bam_base_name}.metrics.h5ad"
+    File peaks_h5 = "~{bam_base_name}.peaks.h5ad" # test
     File atac_library_metrics = "~{bam_base_name}_~{atac_nhash_id}.atac_metrics.csv"
   }
 }

From 6e833d2f3cf02a3ad7cf865651679aee0c8f914a Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Wed, 16 Oct 2024 16:59:52 -0400
Subject: [PATCH 03/91] fix

---
 pipelines/skylab/atac/atac.wdl | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 61f38361d6..c547c0ce8e 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -537,7 +537,7 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
-    peakcalling_bool = true
+    peakcalling_bool = True
 
     # calculate chrom size dictionary based on text file
     chrom_size_dict={}
@@ -554,7 +554,7 @@ task CreateFragmentFile {
     import csv
 
     # extract CB or BB (if preindex is true) tag from bam file to create fragment file
-    if preindex:
+    if preindex == "true":
         data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="BB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
     else:
         data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="CB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)

From 76286b482f916296c02f21e6c703b85be8da2c6b Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Wed, 16 Oct 2024 17:45:15 -0400
Subject: [PATCH 04/91] fix

---
 pipelines/skylab/atac/atac.wdl | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index c547c0ce8e..15e938c3e5 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -590,10 +590,10 @@ task CreateFragmentFile {
         print("Peak calling using MACS3")
         snap.tl.macs3(atac_data) # were not including cell type?
         print("test")
-        print(data.uns['macs3'])
+        print(atac_data.uns['macs3'])
 
         print("Writing peak files")
-        for k, peaks in data.uns['macs3'].items():
+        for k, peaks in atac_data.uns['macs3'].items():
             peaks.to_csv(f'{k}.NarrowPeak', sep='\t', header=False, index=False)
         ls 
     

From 90805ca0736cdce0c3c0e0b16c565a89ceaea06d Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Wed, 16 Oct 2024 18:33:48 -0400
Subject: [PATCH 05/91] test

---
 pipelines/skylab/atac/atac.wdl | 5 -----
 1 file changed, 5 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 15e938c3e5..6073ac0cfb 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -590,11 +590,6 @@ task CreateFragmentFile {
         print("Peak calling using MACS3")
         snap.tl.macs3(atac_data) # were not including cell type?
         print("test")
-        print(atac_data.uns['macs3'])
-
-        print("Writing peak files")
-        for k, peaks in atac_data.uns['macs3'].items():
-            peaks.to_csv(f'{k}.NarrowPeak', sep='\t', header=False, index=False)
         ls 
     
     # Write atac file

From b27011c80bd5cea6cb3d79e03b68e2494754fb52 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Thu, 17 Oct 2024 11:27:40 -0400
Subject: [PATCH 06/91] remove ls

---
 pipelines/skylab/atac/atac.wdl | 1 -
 1 file changed, 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 6073ac0cfb..2326d27b64 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -590,7 +590,6 @@ task CreateFragmentFile {
         print("Peak calling using MACS3")
         snap.tl.macs3(atac_data) # were not including cell type?
         print("test")
-        ls 
     
     # Write atac file
     print("Writing h5ad file with peaks")

From c1f0e5709aedf2a4460695619575fb4e45a599ba Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 18 Oct 2024 09:41:05 -0400
Subject: [PATCH 07/91] test

---
 pipelines/skylab/atac/atac.wdl | 51 ++++++++++++++++++++++++++++++++--
 1 file changed, 49 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 2326d27b64..e354ca13a8 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -550,6 +550,7 @@ task CreateFragmentFile {
     import snapatac2.preprocessing as pp
     import snapatac2 as snap
     import anndata as ad
+    import scanpy as sc
     from collections import OrderedDict
     import csv
 
@@ -585,10 +586,56 @@ task CreateFragmentFile {
     snap.metrics.tsse(atac_data, atac_gtf)
     atac_data.write_h5ad("~{bam_base_name}.metrics.h5ad")
 
-    # peak calling? https://kzhang.org/SnapATAC2/tutorials/diff.html#Peak-calling-at-the-cluster-level
+    # Peak calling
     if peakcalling_bool:
+        print("Peak calling")
+        # Calculate and plot the size distribution of fragments
+        print("1.1 Calculating fragment size distribution")
+        snap.pl.frag_size_distr(atac_data)
+        # Need to parameterize 
+        # Filter cells
+        print("1.2 Filtering cells")
+        snap.pp.filter_cells(atac_data, min_counts=5000, min_tsse=10, max_counts=100000)
+        print(atac_data)
+        # Create a cell by bin matrix containing insertion counts across genome-wide 500-bp bins.
+        print("1.3 Creating cell by bin matrix")
+        snap.pp.add_tile_matrix(atac_data)
+        print(atac_data)
+        # Feature selection
+        print("1.4 Feature selection")
+        snap.pp.select_features(atac_data)
+        # Run customized scrublet algorithm to identify potential doublets
+        print("1.5 Run scrublet to identify potential doublets")
+        snap.pp.scrublet(atac_data)
+        # Employ spectral embedding for dimensionality reduction
+        print("1.6 Employ spectral embedding for dimensionality reduction")
+        snap.tl.spectral(atac_data)
+        # Filter doublets based on scrublet scores 
+        print("1.7 Filter doublets based on scrublet scores")
+        snap.pp.filter_doublets(atac_data, probability_threshold=0.5)
+        # Perform graph-based clustering to identify cell clusters. 
+        # Build a k-nearest neighbour graph using snap.pp.knn
+        print("1.8 Perform knn graph-based clustering to identify cell clusters")
+        snap.pp.knn(atac_data)
+        # Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph
+        print("1.9 Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph")
+        snap.tl.leiden(atac_data)
+        # Create the cell by gene activity matrix
+        print("1.10 Create the cell by gene activity matrix")
+        gene_mat = snap.pp.make_gene_matrix(atac_data, gene_anno=atac_gtf)
+        # Normalize the gene matrix
+        print("1.11 Normalize the gene matrix")
+        gene_mat.obs['leiden'] = atac_data.obs['leiden']
+        sc.pp.normalize_total(gene_mat)
+        sc.pp.log1p(gene_mat)
+        sc.tl.rank_genes_groups(gene_mat, groupby="leiden", method="wilcoxon")
+        
+        for i in np.unique(gene_mat.obs['leiden']):
+            markers = sc.get.rank_genes_groups_df(gene_mat, group=i).head(7)['names']
+            print(f"Cluster {i}: {', '.join(markers)}")
+
         print("Peak calling using MACS3")
-        snap.tl.macs3(atac_data) # were not including cell type?
+        snap.tl.macs3(atac_data, groupby='leiden')
         print("test")
     
     # Write atac file

From 779fe9bd27d4cb0cb8efad0e2fc9842f9685c765 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 18 Oct 2024 13:23:45 -0400
Subject: [PATCH 08/91] test

---
 pipelines/skylab/atac/atac.wdl | 71 ++++++++++++++++++++++------------
 1 file changed, 46 insertions(+), 25 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index e354ca13a8..87b2cf9e83 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -588,44 +588,63 @@ task CreateFragmentFile {
 
     # Peak calling
     if peakcalling_bool:
-        print("Peak calling")
+        print("Peak calling starting...")
+
         # Calculate and plot the size distribution of fragments
-        print("1.1 Calculating fragment size distribution")
+        print("Calculating fragment size distribution")
         snap.pl.frag_size_distr(atac_data)
-        # Need to parameterize 
-        # Filter cells
-        print("1.2 Filtering cells")
+        print(atac_data)
+
+        # Filter cells -- Need to parameterize 
+        print("Filtering cells")
         snap.pp.filter_cells(atac_data, min_counts=5000, min_tsse=10, max_counts=100000)
         print(atac_data)
+       
         # Create a cell by bin matrix containing insertion counts across genome-wide 500-bp bins.
-        print("1.3 Creating cell by bin matrix")
-        snap.pp.add_tile_matrix(atac_data)
-        print(atac_data)
+        print("Creating cell by bin matrix")
+        atac_data_mod = snap.pp.add_tile_matrix(atac_data)
+        atac_data_mod.obsm = atac_data.obsm
+        print(atac_data_mod)
+       
         # Feature selection
-        print("1.4 Feature selection")
-        snap.pp.select_features(atac_data)
+        print("Feature selection")
+        snap.pp.select_features(atac_data_mod)
+        print(atac_data_mod)
+        
         # Run customized scrublet algorithm to identify potential doublets
-        print("1.5 Run scrublet to identify potential doublets")
-        snap.pp.scrublet(atac_data)
+        print("Run scrublet to identify potential doublets")
+        snap.pp.scrublet(atac_data_mod)
+        print(atac_data_mod)
+        
         # Employ spectral embedding for dimensionality reduction
-        print("1.6 Employ spectral embedding for dimensionality reduction")
-        snap.tl.spectral(atac_data)
+        print("Employ spectral embedding for dimensionality reduction")
+        snap.tl.spectral(atac_data_mod)
+        print(atac_data_mod)
+        
         # Filter doublets based on scrublet scores 
-        print("1.7 Filter doublets based on scrublet scores")
-        snap.pp.filter_doublets(atac_data, probability_threshold=0.5)
+        print("Filter doublets based on scrublet scores")
+        snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.5)
+        print(atac_data_mod)
+        
         # Perform graph-based clustering to identify cell clusters. 
         # Build a k-nearest neighbour graph using snap.pp.knn
-        print("1.8 Perform knn graph-based clustering to identify cell clusters")
-        snap.pp.knn(atac_data)
+        print("Perform knn graph-based clustering to identify cell clusters")
+        snap.pp.knn(atac_data_mod)
+        print(atac_data_mod)
+        
         # Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph
-        print("1.9 Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph")
-        snap.tl.leiden(atac_data)
+        print("Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph")
+        snap.tl.leiden(atac_data_mod)
+        print(atac_data_mod)
+        
         # Create the cell by gene activity matrix
-        print("1.10 Create the cell by gene activity matrix")
-        gene_mat = snap.pp.make_gene_matrix(atac_data, gene_anno=atac_gtf)
+        print("Create the cell by gene activity matrix")
+        gene_mat = snap.pp.make_gene_matrix(atac_data_mod, gene_anno=atac_gtf)
+        print(atac_data_mod)
+
         # Normalize the gene matrix
-        print("1.11 Normalize the gene matrix")
-        gene_mat.obs['leiden'] = atac_data.obs['leiden']
+        print("Normalize the gene matrix")
+        gene_mat.obs['leiden'] = atac_data_mod.obs['leiden']
         sc.pp.normalize_total(gene_mat)
         sc.pp.log1p(gene_mat)
         sc.tl.rank_genes_groups(gene_mat, groupby="leiden", method="wilcoxon")
@@ -635,7 +654,9 @@ task CreateFragmentFile {
             print(f"Cluster {i}: {', '.join(markers)}")
 
         print("Peak calling using MACS3")
-        snap.tl.macs3(atac_data, groupby='leiden')
+        snap.tl.macs3(atac_data_mod, groupby='leiden')
+
+        print(atac_data_mod.uns['macs3'])
         print("test")
     
     # Write atac file

From 5743eff9753a3ccb183730ea275c59003aa4c89c Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 18 Oct 2024 13:38:54 -0400
Subject: [PATCH 09/91] test

---
 pipelines/skylab/atac/atac.wdl | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 87b2cf9e83..1d3a03d2fe 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -527,7 +527,8 @@ task CreateFragmentFile {
 
   command <<<
     set -e pipefail
-
+    pip3 install snapatac2==2.7.0 scanpy
+    
     python3 <<CODE
 
     # set parameters

From d3749c887738e9dc09524072a7e3c5306078dd86 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 18 Oct 2024 14:09:06 -0400
Subject: [PATCH 10/91] test

---
 pipelines/skylab/atac/atac.wdl | 1 +
 1 file changed, 1 insertion(+)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 1d3a03d2fe..ab32f30397 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -605,6 +605,7 @@ task CreateFragmentFile {
         print("Creating cell by bin matrix")
         atac_data_mod = snap.pp.add_tile_matrix(atac_data)
         atac_data_mod.obsm = atac_data.obsm
+        new_adata.uns["reference_sequences"] = atac_data.uns["reference_sequences"]
         print(atac_data_mod)
        
         # Feature selection

From 1de1c85103a0edb23d234bce4adc714f7d000bc2 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 18 Oct 2024 15:38:37 -0400
Subject: [PATCH 11/91] test

---
 pipelines/skylab/atac/atac.wdl | 8 ++++++--
 1 file changed, 6 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index ab32f30397..d7d2e5b34f 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -526,7 +526,9 @@ task CreateFragmentFile {
   }
 
   command <<<
-    set -e pipefail
+    set -eou pipefail
+    set -x 
+    # install packages -- need to add to the docker
     pip3 install snapatac2==2.7.0 scanpy
     
     python3 <<CODE
@@ -538,7 +540,7 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
-    peakcalling_bool = True
+    peakcalling_bool = False
 
     # calculate chrom size dictionary based on text file
     chrom_size_dict={}
@@ -604,7 +606,9 @@ task CreateFragmentFile {
         # Create a cell by bin matrix containing insertion counts across genome-wide 500-bp bins.
         print("Creating cell by bin matrix")
         atac_data_mod = snap.pp.add_tile_matrix(atac_data)
+        print("set obsm")
         atac_data_mod.obsm = atac_data.obsm
+        print("set uns")
         new_adata.uns["reference_sequences"] = atac_data.uns["reference_sequences"]
         print(atac_data_mod)
        

From 2d18756e646b0cb564469ebb5c15409f5be40d08 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 18 Oct 2024 15:59:36 -0400
Subject: [PATCH 12/91] test

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index d7d2e5b34f..90953769fa 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -540,7 +540,7 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
-    peakcalling_bool = False
+    peakcalling_bool = True
 
     # calculate chrom size dictionary based on text file
     chrom_size_dict={}

From 13a44f9ff6eef6356d34a528f2aeb88f7a348581 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 21 Oct 2024 10:11:17 -0400
Subject: [PATCH 13/91] test

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 90953769fa..ae563eb49a 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -607,7 +607,7 @@ task CreateFragmentFile {
         print("Creating cell by bin matrix")
         atac_data_mod = snap.pp.add_tile_matrix(atac_data)
         print("set obsm")
-        atac_data_mod.obsm = atac_data.obsm
+        atac_data_mod.obsm["fragment_paired"] =  atac_data.obsm["fragment_paired"]
         print("set uns")
         new_adata.uns["reference_sequences"] = atac_data.uns["reference_sequences"]
         print(atac_data_mod)

From 3f12b9e3dc84031a401132792d6c7e6ff9549c96 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 21 Oct 2024 16:38:31 -0400
Subject: [PATCH 14/91] made another task

---
 pipelines/skylab/atac/atac.wdl | 198 +++++++++++++++++++--------------
 1 file changed, 113 insertions(+), 85 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index ae563eb49a..db4b94de64 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -155,6 +155,13 @@ workflow ATAC {
     }
   }
 
+  call PeakCalling {
+      input:
+        bam = BWAPairedEndAlignment.bam_aligned_output,
+        annotations_gtf = annotations_gtf,
+        metrics_h5ad = CreateFragmentFile.Snap_metrics
+    }
+
   File bam_aligned_output_atac = select_first([BBTag.bb_bam, BWAPairedEndAlignment.bam_aligned_output])
   File fragment_file_atac = select_first([BB_fragment.fragment_file, CreateFragmentFile.fragment_file])
   File snap_metrics_atac = select_first([BB_fragment.Snap_metrics,CreateFragmentFile.Snap_metrics])
@@ -504,7 +511,6 @@ task CreateFragmentFile {
     File bam
     File annotations_gtf
     File chrom_sizes
-    File annotations_gtf
     Boolean preindex
     Int disk_size = 500
     Int mem_size = 64
@@ -528,9 +534,7 @@ task CreateFragmentFile {
   command <<<
     set -eou pipefail
     set -x 
-    # install packages -- need to add to the docker
-    pip3 install snapatac2==2.7.0 scanpy
-    
+
     python3 <<CODE
 
     # set parameters
@@ -540,7 +544,6 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
-    peakcalling_bool = True
 
     # calculate chrom size dictionary based on text file
     chrom_size_dict={}
@@ -588,101 +591,126 @@ task CreateFragmentFile {
     # calculate tsse metrics
     snap.metrics.tsse(atac_data, atac_gtf)
     atac_data.write_h5ad("~{bam_base_name}.metrics.h5ad")
+    CODE
+  >>>
 
-    # Peak calling
-    if peakcalling_bool:
-        print("Peak calling starting...")
+  runtime {
+    docker: docker_path
+    disks: "local-disk ${disk_size} SSD"
+    memory: "${mem_size} GiB"
+    cpu: nthreads
+    cpuPlatform: cpuPlatform
+  }
+
+  output {
+    File fragment_file = "~{bam_base_name}.fragments.tsv"
+    File Snap_metrics = "~{bam_base_name}.metrics.h5ad"
+    File atac_library_metrics = "~{bam_base_name}_~{atac_nhash_id}.atac_metrics.csv"
+  }
+}
 
-        # Calculate and plot the size distribution of fragments
-        print("Calculating fragment size distribution")
-        snap.pl.frag_size_distr(atac_data)
-        print(atac_data)
 
-        # Filter cells -- Need to parameterize 
-        print("Filtering cells")
-        snap.pp.filter_cells(atac_data, min_counts=5000, min_tsse=10, max_counts=100000)
-        print(atac_data)
+task PeakCalling {
+  input {
+    File bam
+    File annotations_gtf
+    File metrics_h5ad
+  }
+  String bam_base_name = basename(bam, ".bam")
+
+  command <<<
+    set -euo pipefail
+    set -x 
+
+    # install packages -- need to add to the docker
+    pip3 install snapatac2==2.7.0 scanpy
+    
+    python3 <<CODE
+
+     # use snap atac2
+    import snapatac2 as snap
+    import scanpy as sc
+
+    print("Peak calling starting...")
+    atac_data = snap.read(~{metrics_h5ad})
+
+    # Calculate and plot the size distribution of fragments
+    print("Calculating fragment size distribution")
+    snap.pl.frag_size_distr(atac_data)
+    print(atac_data)
+
+    # Filter cells -- Need to parameterize 
+    print("Filtering cells")
+    snap.pp.filter_cells(atac_data, min_counts=5000, min_tsse=10, max_counts=100000)
+    print(atac_data)
        
-        # Create a cell by bin matrix containing insertion counts across genome-wide 500-bp bins.
-        print("Creating cell by bin matrix")
-        atac_data_mod = snap.pp.add_tile_matrix(atac_data)
-        print("set obsm")
-        atac_data_mod.obsm["fragment_paired"] =  atac_data.obsm["fragment_paired"]
-        print("set uns")
-        new_adata.uns["reference_sequences"] = atac_data.uns["reference_sequences"]
-        print(atac_data_mod)
+    # Create a cell by bin matrix containing insertion counts across genome-wide 500-bp bins.
+    print("Creating cell by bin matrix")
+    atac_data_mod = snap.pp.add_tile_matrix(atac_data)
+    print("set obsm")
+    atac_data_mod.obsm["fragment_paired"] =  atac_data.obsm["fragment_paired"]
+    print("set uns")
+    new_adata.uns["reference_sequences"] = atac_data.uns["reference_sequences"]
+    print(atac_data_mod)
        
-        # Feature selection
-        print("Feature selection")
-        snap.pp.select_features(atac_data_mod)
-        print(atac_data_mod)
+    # Feature selection
+    print("Feature selection")
+    snap.pp.select_features(atac_data_mod)
+    print(atac_data_mod)
         
-        # Run customized scrublet algorithm to identify potential doublets
-        print("Run scrublet to identify potential doublets")
-        snap.pp.scrublet(atac_data_mod)
-        print(atac_data_mod)
+    # Run customized scrublet algorithm to identify potential doublets
+    print("Run scrublet to identify potential doublets")
+    snap.pp.scrublet(atac_data_mod)
+    print(atac_data_mod)
         
-        # Employ spectral embedding for dimensionality reduction
-        print("Employ spectral embedding for dimensionality reduction")
-        snap.tl.spectral(atac_data_mod)
-        print(atac_data_mod)
+    # Employ spectral embedding for dimensionality reduction
+    print("Employ spectral embedding for dimensionality reduction")
+    snap.tl.spectral(atac_data_mod)
+    print(atac_data_mod)
         
-        # Filter doublets based on scrublet scores 
-        print("Filter doublets based on scrublet scores")
-        snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.5)
-        print(atac_data_mod)
+    # Filter doublets based on scrublet scores 
+    print("Filter doublets based on scrublet scores")
+    snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.5)
+    print(atac_data_mod)
         
-        # Perform graph-based clustering to identify cell clusters. 
-        # Build a k-nearest neighbour graph using snap.pp.knn
-        print("Perform knn graph-based clustering to identify cell clusters")
-        snap.pp.knn(atac_data_mod)
-        print(atac_data_mod)
+    # Perform graph-based clustering to identify cell clusters. 
+    # Build a k-nearest neighbour graph using snap.pp.knn
+    print("Perform knn graph-based clustering to identify cell clusters")
+    snap.pp.knn(atac_data_mod)
+    print(atac_data_mod)
         
-        # Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph
-        print("Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph")
-        snap.tl.leiden(atac_data_mod)
-        print(atac_data_mod)
+    # Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph
+    print("Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph")
+    snap.tl.leiden(atac_data_mod)
+    print(atac_data_mod)
         
-        # Create the cell by gene activity matrix
-        print("Create the cell by gene activity matrix")
-        gene_mat = snap.pp.make_gene_matrix(atac_data_mod, gene_anno=atac_gtf)
-        print(atac_data_mod)
-
-        # Normalize the gene matrix
-        print("Normalize the gene matrix")
-        gene_mat.obs['leiden'] = atac_data_mod.obs['leiden']
-        sc.pp.normalize_total(gene_mat)
-        sc.pp.log1p(gene_mat)
-        sc.tl.rank_genes_groups(gene_mat, groupby="leiden", method="wilcoxon")
+    # Create the cell by gene activity matrix
+    print("Create the cell by gene activity matrix")
+    gene_mat = snap.pp.make_gene_matrix(atac_data_mod, gene_anno=atac_gtf)
+    print(atac_data_mod)
+
+    # Normalize the gene matrix
+    print("Normalize the gene matrix")
+    gene_mat.obs['leiden'] = atac_data_mod.obs['leiden']
+    sc.pp.normalize_total(gene_mat)
+    sc.pp.log1p(gene_mat)
+    sc.tl.rank_genes_groups(gene_mat, groupby="leiden", method="wilcoxon")
         
-        for i in np.unique(gene_mat.obs['leiden']):
-            markers = sc.get.rank_genes_groups_df(gene_mat, group=i).head(7)['names']
-            print(f"Cluster {i}: {', '.join(markers)}")
+    for i in np.unique(gene_mat.obs['leiden']):
+        markers = sc.get.rank_genes_groups_df(gene_mat, group=i).head(7)['names']
+        print(f"Cluster {i}: {', '.join(markers)}")
 
-        print("Peak calling using MACS3")
-        snap.tl.macs3(atac_data_mod, groupby='leiden')
+    print("Peak calling using MACS3")
+    snap.tl.macs3(atac_data_mod, groupby='leiden')
 
-        print(atac_data_mod.uns['macs3'])
-        print("test")
-    
-    # Write atac file
-    print("Writing h5ad file with peaks")
-    atac_data.write_h5ad("~{bam_base_name}.peaks.h5ad")
+    atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")
+    print("test")
+     
     CODE
   >>>
-
-  runtime {
-    docker: docker_path
-    disks: "local-disk ${disk_size} SSD"
-    memory: "${mem_size} GiB"
-    cpu: nthreads
-    cpuPlatform: cpuPlatform
-  }
-
+  
   output {
-    File fragment_file = "~{bam_base_name}.fragments.tsv"
-    File Snap_metrics = "~{bam_base_name}.metrics.h5ad"
-    File peaks_h5 = "~{bam_base_name}.peaks.h5ad" # test
-    File atac_library_metrics = "~{bam_base_name}_~{atac_nhash_id}.atac_metrics.csv"
+    File peaks_h5ad = "~{bam_base_name}.peaks.h5ad"
   }
-}
+
+}
\ No newline at end of file

From 08b2f2410dca33918a15456bd4963959cbbc6170 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 21 Oct 2024 17:04:27 -0400
Subject: [PATCH 15/91] test

---
 pipelines/skylab/atac/atac.wdl | 38 +++++++++++++++++++++++++++-------
 1 file changed, 31 insertions(+), 7 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index db4b94de64..1a8a5533bd 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -153,14 +153,14 @@ workflow ATAC {
         atac_nhash_id = atac_nhash_id
 
     }
-  }
-
-  call PeakCalling {
+    call PeakCalling {
       input:
         bam = BWAPairedEndAlignment.bam_aligned_output,
         annotations_gtf = annotations_gtf,
-        metrics_h5ad = CreateFragmentFile.Snap_metrics
+        metrics_h5ad = CreateFragmentFile.Snap_metrics,
+        docker_path = docker_prefix + snap_atac_docker
     }
+  }
 
   File bam_aligned_output_atac = select_first([BBTag.bb_bam, BWAPairedEndAlignment.bam_aligned_output])
   File fragment_file_atac = select_first([BB_fragment.fragment_file, CreateFragmentFile.fragment_file])
@@ -267,7 +267,6 @@ task GetNumSplits {
   }
 }
 
-
 # trim read 1 and read 2 adapter sequeunce with cutadapt
 task TrimAdapters {
   input {
@@ -615,8 +614,21 @@ task PeakCalling {
     File bam
     File annotations_gtf
     File metrics_h5ad
+    # copied from previous task
+    Int disk_size = 500
+    Int mem_size = 64
+    Int nthreads = 4
+    String docker_path
   }
   String bam_base_name = basename(bam, ".bam")
+  
+  parameter_meta {
+    bam: "Aligned bam with CB in CB tag. This is the output of the BWAPairedEndAlignment task."
+    annotations_gtf: "GTF for SnapATAC2 to calculate TSS sites of fragment file."
+    disk_size: "Disk size used in create fragment file step."
+    mem_size: "The size of memory used in create fragment file."
+    docker_path: "The docker image path containing the runtime environment for this task"
+  }
 
   command <<<
     set -euo pipefail
@@ -627,12 +639,17 @@ task PeakCalling {
     
     python3 <<CODE
 
-     # use snap atac2
+    # use snap atac2
     import snapatac2 as snap
     import scanpy as sc
 
+    bam = "~{bam}"
+    bam_base_name = "~{bam_base_name}"
+    atac_gtf = "~{annotations_gtf}"
+    metrics_h5ad = "~{metrics_h5ad}"
+
     print("Peak calling starting...")
-    atac_data = snap.read(~{metrics_h5ad})
+    atac_data = snap.read(metrics_h5ad)
 
     # Calculate and plot the size distribution of fragments
     print("Calculating fragment size distribution")
@@ -709,6 +726,13 @@ task PeakCalling {
     CODE
   >>>
   
+  runtime {
+    docker: docker_path
+    disks: "local-disk ${disk_size} SSD"
+    memory: "${mem_size} GiB"
+    cpu: nthreads
+  }
+
   output {
     File peaks_h5ad = "~{bam_base_name}.peaks.h5ad"
   }

From 80c1416b5debd07775a8fefd0b5f0d3038a2bf6c Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 21 Oct 2024 17:19:26 -0400
Subject: [PATCH 16/91] test

---
 pipelines/skylab/atac/atac.wdl | 24 +++++++++++++-----------
 1 file changed, 13 insertions(+), 11 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 1a8a5533bd..d0ef3ee92e 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -510,6 +510,7 @@ task CreateFragmentFile {
     File bam
     File annotations_gtf
     File chrom_sizes
+    File annotations_gtf
     Boolean preindex
     Int disk_size = 500
     Int mem_size = 64
@@ -531,8 +532,7 @@ task CreateFragmentFile {
   }
 
   command <<<
-    set -eou pipefail
-    set -x 
+    set -e pipefail
 
     python3 <<CODE
 
@@ -555,19 +555,17 @@ task CreateFragmentFile {
     import snapatac2.preprocessing as pp
     import snapatac2 as snap
     import anndata as ad
-    import scanpy as sc
     from collections import OrderedDict
     import csv
 
     # extract CB or BB (if preindex is true) tag from bam file to create fragment file
     if preindex == "true":
-        data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="BB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
-    else:
-        data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="CB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
+      data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="BB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
+    elif preindex == "false":
+      data = pp.recipe_10x_metrics("~{bam}", "~{bam_base_name}.fragments.tsv", "temp_metrics.h5ad", is_paired=True, barcode_tag="CB", chrom_sizes=chrom_size_dict, gene_anno=atac_gtf, peaks=None)
     
     # Add NHashID to metrics 
-    nhash_ID_value = "XXX"
-    data = OrderedDict({'NHash_ID': atac_nhash_id, **data})
+    data = OrderedDict({'NHashID': atac_nhash_id, **data})
     # Flatten the dictionary
     flattened_data = []
     for category, metrics in data.items():
@@ -582,6 +580,7 @@ task CreateFragmentFile {
     with open(csv_file_path, mode='w', newline='') as file:
         writer = csv.writer(file)
         writer.writerows(flattened_data)  # Write data
+
     print(f"Dictionary successfully written to {csv_file_path}")
 
     atac_data = ad.read_h5ad("temp_metrics.h5ad")
@@ -589,7 +588,9 @@ task CreateFragmentFile {
     atac_data.uns['NHashID'] = atac_nhash_id
     # calculate tsse metrics
     snap.metrics.tsse(atac_data, atac_gtf)
+    # Write new atac file
     atac_data.write_h5ad("~{bam_base_name}.metrics.h5ad")
+
     CODE
   >>>
 
@@ -608,7 +609,6 @@ task CreateFragmentFile {
   }
 }
 
-
 task PeakCalling {
   input {
     File bam
@@ -666,8 +666,10 @@ task PeakCalling {
     atac_data_mod = snap.pp.add_tile_matrix(atac_data)
     print("set obsm")
     atac_data_mod.obsm["fragment_paired"] =  atac_data.obsm["fragment_paired"]
-    print("set uns")
-    new_adata.uns["reference_sequences"] = atac_data.uns["reference_sequences"]
+    print("set all uns")
+    for key in atac_data.uns.keys():
+      print("set ",key)
+      new_adata.uns[key] = atac_data.uns[key]
     print(atac_data_mod)
        
     # Feature selection

From b5191e526d28b1b8a83dc89c7a792b62d089351e Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 21 Oct 2024 17:44:49 -0400
Subject: [PATCH 17/91] test

---
 pipelines/skylab/atac/atac.wdl | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index d0ef3ee92e..6a39a3472d 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -663,13 +663,13 @@ task PeakCalling {
        
     # Create a cell by bin matrix containing insertion counts across genome-wide 500-bp bins.
     print("Creating cell by bin matrix")
-    atac_data_mod = snap.pp.add_tile_matrix(atac_data)
+    atac_data_mod = snap.pp.add_tile_matrix(atac_data, inplace=False)
     print("set obsm")
     atac_data_mod.obsm["fragment_paired"] =  atac_data.obsm["fragment_paired"]
     print("set all uns")
     for key in atac_data.uns.keys():
       print("set ",key)
-      new_adata.uns[key] = atac_data.uns[key]
+      atac_data_mod.uns[key] = atac_data.uns[key]
     print(atac_data_mod)
        
     # Feature selection

From 4725080516d8cffaa47382c659c3989bbb72775e Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 21 Oct 2024 18:49:20 -0400
Subject: [PATCH 18/91] test

---
 pipelines/skylab/atac/atac.wdl | 1 +
 1 file changed, 1 insertion(+)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 6a39a3472d..28d746600d 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -642,6 +642,7 @@ task PeakCalling {
     # use snap atac2
     import snapatac2 as snap
     import scanpy as sc
+    import numpy as np
 
     bam = "~{bam}"
     bam_base_name = "~{bam_base_name}"

From f139f84743b66aefe5cab0a0c16d7e6838ed7179 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 22 Oct 2024 08:51:50 -0400
Subject: [PATCH 19/91] test

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 28d746600d..8af59d2a3f 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -721,7 +721,7 @@ task PeakCalling {
         print(f"Cluster {i}: {', '.join(markers)}")
 
     print("Peak calling using MACS3")
-    snap.tl.macs3(atac_data_mod, groupby='leiden')
+    snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=1)
 
     atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")
     print("test")

From 9a0ea9b47e5de7dec7d968a001894247351d225e Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 22 Oct 2024 10:08:42 -0400
Subject: [PATCH 20/91] test

---
 pipelines/skylab/atac/atac.wdl | 5 +++--
 1 file changed, 3 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 8af59d2a3f..ccb474acc2 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -720,8 +720,9 @@ task PeakCalling {
         markers = sc.get.rank_genes_groups_df(gene_mat, group=i).head(7)['names']
         print(f"Cluster {i}: {', '.join(markers)}")
 
-    print("Peak calling using MACS3")
-    snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=1)
+    if __name__ == '__main__':
+      print("Peak calling using MACS3")
+      snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=1)
 
     atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")
     print("test")

From 04cf0d2a91df97d737a70ec562fe61cc1301fe15 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 22 Oct 2024 10:28:26 -0400
Subject: [PATCH 21/91] test

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index ccb474acc2..5227c534ff 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -722,7 +722,7 @@ task PeakCalling {
 
     if __name__ == '__main__':
       print("Peak calling using MACS3")
-      snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=1)
+      snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=8)
 
     atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")
     print("test")

From f9bc8718b488bc13d1e20028fe56a2180d81013b Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Thu, 24 Oct 2024 12:58:18 -0400
Subject: [PATCH 22/91] change a line

---
 pipelines/skylab/atac/atac.wdl | 3 +++
 1 file changed, 3 insertions(+)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 5227c534ff..9576c42602 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -637,6 +637,9 @@ task PeakCalling {
     # install packages -- need to add to the docker
     pip3 install snapatac2==2.7.0 scanpy
     
+    file_to_change=/usr/local/lib/python3.10/site-packages/snapatac2/tools/_call_peaks.py
+    sed -i '164s/.*/\tpeaks = [_call_peaks(x) for x in fragments.values()]/' $file_to_change
+
     python3 <<CODE
 
     # use snap atac2

From 93d336027ba928a383030bac85c5b03d4b098c20 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Thu, 24 Oct 2024 14:44:52 -0400
Subject: [PATCH 23/91] test

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 9576c42602..5c57a7c6ba 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -638,7 +638,7 @@ task PeakCalling {
     pip3 install snapatac2==2.7.0 scanpy
     
     file_to_change=/usr/local/lib/python3.10/site-packages/snapatac2/tools/_call_peaks.py
-    sed -i '164s/.*/\tpeaks = [_call_peaks(x) for x in fragments.values()]/' $file_to_change
+    sed -i '164s/.*/peaks = [_call_peaks(x) for x in fragments.values()]/' $file_to_change
 
     python3 <<CODE
 

From 256c4e5d4e3b697544c19bdbf1b1dcb38f01c0e3 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Thu, 24 Oct 2024 15:10:32 -0400
Subject: [PATCH 24/91] test

---
 pipelines/skylab/atac/atac.wdl | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 5c57a7c6ba..60bd780f22 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -638,7 +638,7 @@ task PeakCalling {
     pip3 install snapatac2==2.7.0 scanpy
     
     file_to_change=/usr/local/lib/python3.10/site-packages/snapatac2/tools/_call_peaks.py
-    sed -i '164s/.*/peaks = [_call_peaks(x) for x in fragments.values()]/' $file_to_change
+    sed -i '164s/.*/\t\t\t\tpeaks = [_call_peaks(x) for x in fragments.values()]/' $file_to_change
 
     python3 <<CODE
 
@@ -744,4 +744,4 @@ task PeakCalling {
     File peaks_h5ad = "~{bam_base_name}.peaks.h5ad"
   }
 
-}
\ No newline at end of file
+}

From cd849b5e0c225778dd35da012567237ad0fc1f64 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Thu, 24 Oct 2024 16:00:38 -0400
Subject: [PATCH 25/91] test

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 60bd780f22..563796f72f 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -638,7 +638,7 @@ task PeakCalling {
     pip3 install snapatac2==2.7.0 scanpy
     
     file_to_change=/usr/local/lib/python3.10/site-packages/snapatac2/tools/_call_peaks.py
-    sed -i '164s/.*/\t\t\t\tpeaks = [_call_peaks(x) for x in fragments.values()]/' $file_to_change
+    sed -i '164s/.*/        peaks = [_call_peaks(x) for x in fragments.values()]/' $file_to_change
 
     python3 <<CODE
 

From 7c62fd1161a83e2547e8a56e398ea31ee1ac6e0c Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Thu, 24 Oct 2024 18:50:22 -0400
Subject: [PATCH 26/91] test

---
 pipelines/skylab/atac/atac.wdl | 29 ++++++++++++++++++++++++-----
 1 file changed, 24 insertions(+), 5 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 563796f72f..e11f6853c2 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -646,6 +646,7 @@ task PeakCalling {
     import snapatac2 as snap
     import scanpy as sc
     import numpy as np
+    import polars as pl
 
     bam = "~{bam}"
     bam_base_name = "~{bam_base_name}"
@@ -723,11 +724,29 @@ task PeakCalling {
         markers = sc.get.rank_genes_groups_df(gene_mat, group=i).head(7)['names']
         print(f"Cluster {i}: {', '.join(markers)}")
 
-    if __name__ == '__main__':
-      print("Peak calling using MACS3")
-      snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=8)
-
-    atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")
+    
+    print("Peak calling using MACS3")
+    snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=8)
+    
+    print("NarrowPeak")
+    for k, peaks in atac_data_mod.uns['macs3'].items():
+        peaks.to_csv(f'{k}.NarrowPeak', sep='\t', header=False, index=False)
+    
+    print("test")
+    snap.ex.export_coverage(
+      atac_data_mod,
+      groupby='leiden',
+    )
+
+    print("Convert pl.DataFrame to pandas DataFrame")
+    # Convert pl.DataFrame to pandas DataFrame
+    for key in new_adata.uns.keys():
+      if isinstance(new_adata.uns[key], pl.DataFrame):
+          print(key)
+          new_adata.uns[key] = new_adata.uns[key].to_pandas()
+
+    print("Write into h5ad file")
+    atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad", compression='gzip')
     print("test")
      
     CODE

From b15b146281e944f4a809ac364870a84fc387b458 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Thu, 24 Oct 2024 18:50:52 -0400
Subject: [PATCH 27/91] test

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index e11f6853c2..f645309639 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -746,7 +746,7 @@ task PeakCalling {
           new_adata.uns[key] = new_adata.uns[key].to_pandas()
 
     print("Write into h5ad file")
-    atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad", compression='gzip')
+    atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")
     print("test")
      
     CODE

From ff36c155c5b010c117ed3d34c9574344f54e0fe2 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Thu, 24 Oct 2024 18:51:29 -0400
Subject: [PATCH 28/91] test

---
 pipelines/skylab/atac/atac.wdl | 11 -----------
 1 file changed, 11 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index f645309639..dc41406540 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -724,20 +724,9 @@ task PeakCalling {
         markers = sc.get.rank_genes_groups_df(gene_mat, group=i).head(7)['names']
         print(f"Cluster {i}: {', '.join(markers)}")
 
-    
     print("Peak calling using MACS3")
     snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=8)
     
-    print("NarrowPeak")
-    for k, peaks in atac_data_mod.uns['macs3'].items():
-        peaks.to_csv(f'{k}.NarrowPeak', sep='\t', header=False, index=False)
-    
-    print("test")
-    snap.ex.export_coverage(
-      atac_data_mod,
-      groupby='leiden',
-    )
-
     print("Convert pl.DataFrame to pandas DataFrame")
     # Convert pl.DataFrame to pandas DataFrame
     for key in new_adata.uns.keys():

From 27a419678613a1a624cdbcab2f7426a0476a9e34 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Thu, 24 Oct 2024 19:49:17 -0400
Subject: [PATCH 29/91] test

---
 pipelines/skylab/atac/atac.wdl | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index dc41406540..41abc21bcd 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -729,10 +729,10 @@ task PeakCalling {
     
     print("Convert pl.DataFrame to pandas DataFrame")
     # Convert pl.DataFrame to pandas DataFrame
-    for key in new_adata.uns.keys():
-      if isinstance(new_adata.uns[key], pl.DataFrame):
+    for key in atac_data_mod.uns.keys():
+      if isinstance(atac_data_mod.uns[key], pl.DataFrame):
           print(key)
-          new_adata.uns[key] = new_adata.uns[key].to_pandas()
+          atac_data_mod.uns[key] = atac_data_mod.uns[key].to_pandas()
 
     print("Write into h5ad file")
     atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")

From 987b5d2d6f0bb8201d13e7fd1936eb992dba03e0 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 28 Oct 2024 15:02:49 -0400
Subject: [PATCH 30/91] Add peakcall to task

---
 pipelines/skylab/atac/atac.wdl | 96 +++++++++++++++++++++++++++++++++-
 1 file changed, 95 insertions(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 41abc21bcd..6b563244e9 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -532,7 +532,14 @@ task CreateFragmentFile {
   }
 
   command <<<
-    set -e pipefail
+    set -euo pipefail
+    set -x 
+
+    # install packages -- need to add to the docker
+    pip3 install snapatac2==2.7.0 scanpy
+    
+    file_to_change=/usr/local/lib/python3.10/site-packages/snapatac2/tools/_call_peaks.py
+    sed -i '164s/.*/        peaks = [_call_peaks(x) for x in fragments.values()]/' $file_to_change
 
     python3 <<CODE
 
@@ -543,6 +550,7 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
+    peakcalling_bool = True 
 
     # calculate chrom size dictionary based on text file
     chrom_size_dict={}
@@ -591,6 +599,92 @@ task CreateFragmentFile {
     # Write new atac file
     atac_data.write_h5ad("~{bam_base_name}.metrics.h5ad")
 
+    if peakcalling_bool:
+        print("Peak calling starting...")
+        atac_data = snap.read("~{bam_base_name}.metrics.h5ad")
+
+        # Calculate and plot the size distribution of fragments
+        print("Calculating fragment size distribution")
+        snap.pl.frag_size_distr(atac_data)
+        print(atac_data)
+
+        # Filter cells -- Need to parameterize 
+        print("Filtering cells")
+        snap.pp.filter_cells(atac_data, min_counts=5000, min_tsse=10, max_counts=100000)
+        print(atac_data)
+       
+        # Create a cell by bin matrix containing insertion counts across genome-wide 500-bp bins.
+        print("Creating cell by bin matrix")
+        atac_data_mod = snap.pp.add_tile_matrix(atac_data, inplace=False)
+        print("set obsm")
+        atac_data_mod.obsm["fragment_paired"] =  atac_data.obsm["fragment_paired"]
+        print("set all uns")
+        for key in atac_data.uns.keys():
+            print("set ",key)
+            atac_data_mod.uns[key] = atac_data.uns[key]
+        print(atac_data_mod)
+       
+        # Feature selection
+        print("Feature selection")
+        snap.pp.select_features(atac_data_mod)
+        print(atac_data_mod)
+        
+        # Run customized scrublet algorithm to identify potential doublets
+        print("Run scrublet to identify potential doublets")
+        snap.pp.scrublet(atac_data_mod)
+        print(atac_data_mod)
+        
+        # Employ spectral embedding for dimensionality reduction
+        print("Employ spectral embedding for dimensionality reduction")
+        snap.tl.spectral(atac_data_mod)
+        print(atac_data_mod)
+            
+        # Filter doublets based on scrublet scores 
+        print("Filter doublets based on scrublet scores")
+        snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.5)
+        print(atac_data_mod)
+        
+        # Perform graph-based clustering to identify cell clusters. 
+        # Build a k-nearest neighbour graph using snap.pp.knn
+        print("Perform knn graph-based clustering to identify cell clusters")
+        snap.pp.knn(atac_data_mod)
+        print(atac_data_mod)
+            
+        # Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph
+        print("Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph")
+        snap.tl.leiden(atac_data_mod)
+        print(atac_data_mod)
+        
+        # Create the cell by gene activity matrix
+        print("Create the cell by gene activity matrix")
+        gene_mat = snap.pp.make_gene_matrix(atac_data_mod, gene_anno=atac_gtf)
+        print(atac_data_mod)
+
+        # Normalize the gene matrix
+        print("Normalize the gene matrix")
+        gene_mat.obs['leiden'] = atac_data_mod.obs['leiden']
+        sc.pp.normalize_total(gene_mat)
+        sc.pp.log1p(gene_mat)
+        sc.tl.rank_genes_groups(gene_mat, groupby="leiden", method="wilcoxon")
+            
+        for i in np.unique(gene_mat.obs['leiden']):
+            markers = sc.get.rank_genes_groups_df(gene_mat, group=i).head(7)['names']
+            print(f"Cluster {i}: {', '.join(markers)}")
+
+        print("Peak calling using MACS3")
+        snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=8)
+        
+        print("Convert pl.DataFrame to pandas DataFrame")
+        # Convert pl.DataFrame to pandas DataFrame
+        for key in atac_data_mod.uns.keys():
+          if isinstance(atac_data_mod.uns[key], pl.DataFrame):
+              print(key)
+              atac_data_mod.uns[key] = atac_data_mod.uns[key].to_pandas()
+
+        print("Write into h5ad file")
+        atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")
+        print("test")
+
     CODE
   >>>
 

From cce58417212c7d576a7a049cd66579d010bf3cae Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 28 Oct 2024 15:21:15 -0400
Subject: [PATCH 31/91] test

---
 pipelines/skylab/atac/atac.wdl | 3 +++
 1 file changed, 3 insertions(+)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 6b563244e9..265bb5e90e 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -562,6 +562,9 @@ task CreateFragmentFile {
     # use snap atac2
     import snapatac2.preprocessing as pp
     import snapatac2 as snap
+    import scanpy as sc
+    import numpy as np
+    import polars as pl
     import anndata as ad
     from collections import OrderedDict
     import csv

From bf0e9ce33829aafd1166d96fc08c6183effda6da Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 28 Oct 2024 17:57:44 -0400
Subject: [PATCH 32/91] add parameters

---
 pipelines/skylab/atac/atac.wdl | 21 +++++++++++++++------
 1 file changed, 15 insertions(+), 6 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 265bb5e90e..974578dbd7 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -710,12 +710,17 @@ task PeakCalling {
   input {
     File bam
     File annotations_gtf
-    File metrics_h5ad
-    # copied from previous task
+    File metrics_h5ad   
+    # SnapATAC2 parameters
+    Int min_counts = 5000
+    Int min_tsse = 10
+    Int max_counts = 100000
+    Int doublet_probability_threshold = 0.5
+    # Runtime attributes/docker
+    String docker_path
     Int disk_size = 500
     Int mem_size = 64
-    Int nthreads = 4
-    String docker_path
+    Int nthreads = 4   
   }
   String bam_base_name = basename(bam, ".bam")
   
@@ -749,6 +754,10 @@ task PeakCalling {
     bam_base_name = "~{bam_base_name}"
     atac_gtf = "~{annotations_gtf}"
     metrics_h5ad = "~{metrics_h5ad}"
+    min_counts = "~{min_counts}"
+    min_tsse = "~{min_tsse}"
+    max_counts = "~{max_counts}"
+    probability_threshold = "~{doublet_probability_threshold}"
 
     print("Peak calling starting...")
     atac_data = snap.read(metrics_h5ad)
@@ -760,7 +769,7 @@ task PeakCalling {
 
     # Filter cells -- Need to parameterize 
     print("Filtering cells")
-    snap.pp.filter_cells(atac_data, min_counts=5000, min_tsse=10, max_counts=100000)
+    snap.pp.filter_cells(atac_data, min_counts=min_counts, min_tsse=min_tsse, max_counts=max_counts)
     print(atac_data)
        
     # Create a cell by bin matrix containing insertion counts across genome-wide 500-bp bins.
@@ -791,7 +800,7 @@ task PeakCalling {
         
     # Filter doublets based on scrublet scores 
     print("Filter doublets based on scrublet scores")
-    snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.5)
+    snap.pp.filter_doublets(atac_data_mod, probability_threshold=probability_threshold)
     print(atac_data_mod)
         
     # Perform graph-based clustering to identify cell clusters. 

From 18f77d8d0189ba30ec445b88ace4ba528be8882b Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 4 Nov 2024 09:46:07 -0500
Subject: [PATCH 33/91] test

---
 pipelines/skylab/atac/atac.wdl | 4 +---
 1 file changed, 1 insertion(+), 3 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 89646be7ea..8ac108e959 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -715,7 +715,6 @@ task PeakCalling {
     Int min_counts = 5000
     Int min_tsse = 10
     Int max_counts = 100000
-    Int doublet_probability_threshold = 0.5
     # Runtime attributes/docker
     String docker_path
     Int disk_size = 500
@@ -757,7 +756,6 @@ task PeakCalling {
     min_counts = "~{min_counts}"
     min_tsse = "~{min_tsse}"
     max_counts = "~{max_counts}"
-    probability_threshold = "~{doublet_probability_threshold}"
 
     print("Peak calling starting...")
     atac_data = snap.read(metrics_h5ad)
@@ -800,7 +798,7 @@ task PeakCalling {
         
     # Filter doublets based on scrublet scores 
     print("Filter doublets based on scrublet scores")
-    snap.pp.filter_doublets(atac_data_mod, probability_threshold=probability_threshold)
+    snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.5)
     print(atac_data_mod)
         
     # Perform graph-based clustering to identify cell clusters. 

From db59231f001dfa60306e62f23cc024b1b9fdcbd4 Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Fri, 13 Dec 2024 10:24:41 -0500
Subject: [PATCH 34/91] peak calling

---
 pipelines/skylab/atac/atac.wdl | 7 +------
 1 file changed, 1 insertion(+), 6 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 7e42a65802..87df29afa0 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -763,13 +763,8 @@ task PeakCalling {
   command <<<
     set -euo pipefail
     set -x 
-
-    # install packages -- need to add to the docker
-    pip3 install snapatac2==2.7.0 scanpy
     
     file_to_change=/usr/local/lib/python3.10/site-packages/snapatac2/tools/_call_peaks.py
-    sed -i '164s/.*/        peaks = [_call_peaks(x) for x in fragments.values()]/' $file_to_change
-
     python3 <<CODE
 
     # use snap atac2
@@ -858,7 +853,7 @@ task PeakCalling {
         print(f"Cluster {i}: {', '.join(markers)}")
 
     print("Peak calling using MACS3")
-    snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=8)
+    snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=1)
     
     print("Convert pl.DataFrame to pandas DataFrame")
     # Convert pl.DataFrame to pandas DataFrame

From 0d4f0108e205be974fe9370fecf5caa56d2dcee3 Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Fri, 13 Dec 2024 11:00:33 -0500
Subject: [PATCH 35/91] remove bam_base_name from CreateFragments task

---
 pipelines/skylab/atac/atac.wdl | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 3290d22498..0a55334c15 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -625,7 +625,7 @@ task CreateFragmentFile {
 
     if peakcalling_bool:
         print("Peak calling starting...")
-        atac_data = snap.read("~{bam_base_name}.metrics.h5ad")
+        atac_data = snap.read("~{input_id}.metrics.h5ad")
 
         # Calculate and plot the size distribution of fragments
         print("Calculating fragment size distribution")
@@ -706,7 +706,7 @@ task CreateFragmentFile {
               atac_data_mod.uns[key] = atac_data_mod.uns[key].to_pandas()
 
         print("Write into h5ad file")
-        atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")
+        atac_data_mod.write_h5ad("~{input_id}.peaks.h5ad")
         print("test")
 
     CODE

From 987e1e527e5cf1d4de8436aaa4ccdaddb7c79c48 Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Fri, 13 Dec 2024 11:10:40 -0500
Subject: [PATCH 36/91] separate task for macs3 consistent with create
 fragments

---
 pipelines/skylab/atac/atac.wdl | 9 +--------
 1 file changed, 1 insertion(+), 8 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 0a55334c15..e03edb7e2c 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -542,12 +542,6 @@ task CreateFragmentFile {
     set -euo pipefail
     set -x 
 
-    # install packages -- need to add to the docker
-    pip3 install snapatac2==2.7.0 scanpy
-    
-    file_to_change=/usr/local/lib/python3.10/site-packages/snapatac2/tools/_call_peaks.py
-    sed -i '164s/.*/        peaks = [_call_peaks(x) for x in fragments.values()]/' $file_to_change
-
     python3 <<CODE
 
     # set parameters
@@ -696,7 +690,7 @@ task CreateFragmentFile {
             print(f"Cluster {i}: {', '.join(markers)}")
 
         print("Peak calling using MACS3")
-        snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=8)
+        snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=1)
         
         print("Convert pl.DataFrame to pandas DataFrame")
         # Convert pl.DataFrame to pandas DataFrame
@@ -766,7 +760,6 @@ task PeakCalling {
     set -euo pipefail
     set -x 
     
-    file_to_change=/usr/local/lib/python3.10/site-packages/snapatac2/tools/_call_peaks.py
     python3 <<CODE
 
     # use snap atac2

From 0bc38f66de6b1db5860258a12870e66549e7a126 Mon Sep 17 00:00:00 2001
From: Robert Sidney Cox <sidcox@broadinstitute.org>
Date: Mon, 16 Dec 2024 09:40:14 -0500
Subject: [PATCH 37/91] Update atac.wdl

update snap_atac_docker tag to 2.0.0
---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index e03edb7e2c..ffd4ae3f0e 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -61,7 +61,7 @@ workflow ATAC {
   String cutadapt_docker = "cutadapt:1.0.0-4.4-1686752919"
   String samtools_docker = "samtools-dist-bwa:3.0.0"
   String upstools_docker = "upstools:1.0.0-2023.03.03-1704300311"
-  String snap_atac_docker = "snapatac2:1.1.0"
+  String snap_atac_docker = "snapatac2:2.0.0"
 
   # Make sure either 'gcp' or 'azure' is supplied as cloud_provider input. If not, raise an error
   if ((cloud_provider != "gcp") && (cloud_provider != "azure")) {

From b136ba30e94df8895f0def5592c012cd87be7628 Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Mon, 16 Dec 2024 10:26:30 -0500
Subject: [PATCH 38/91] snapatac2 updates

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index ffd4ae3f0e..a2375ad802 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -551,7 +551,7 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
-    peakcalling_bool = True 
+    peakcalling_bool = True # set peakcalling
     expected_cells = ~{atac_expected_cells}
 
     # calculate chrom size dictionary based on text file

From 573a29fea508cc75552bcd4b76b7bfddb8d02817 Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Mon, 13 Jan 2025 15:12:49 -0500
Subject: [PATCH 39/91] turn off createfragments peakcalling

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index a2375ad802..868ddbf161 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -551,7 +551,7 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
-    peakcalling_bool = True # set peakcalling
+    peakcalling_bool = False # set peakcalling
     expected_cells = ~{atac_expected_cells}
 
     # calculate chrom size dictionary based on text file

From 7b8d1fcb82d503f2ed12b66d9f33511ceca7d8ee Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Tue, 14 Jan 2025 08:53:19 -0500
Subject: [PATCH 40/91] remove peakcalling from createfragments and
 parameterize probability_threshold

---
 pipelines/skylab/atac/atac.wdl | 93 ++--------------------------------
 1 file changed, 3 insertions(+), 90 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 868ddbf161..f9edb0362b 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -551,7 +551,6 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
-    peakcalling_bool = False # set peakcalling
     expected_cells = ~{atac_expected_cells}
 
     # calculate chrom size dictionary based on text file
@@ -587,8 +586,7 @@ task CreateFragmentFile {
     atac_percent_target = number_of_cells / expected_cells*100
     print("Setting percent target in nested dictionary")
     data['Cells']['atac_percent_target'] = atac_percent_target
-    
-    
+
     # Flatten the dictionary
     flattened_data = []
     for category, metrics in data.items():
@@ -617,92 +615,6 @@ task CreateFragmentFile {
     # Write new atac file
     atac_data.write_h5ad("~{input_id}.metrics.h5ad")
 
-    if peakcalling_bool:
-        print("Peak calling starting...")
-        atac_data = snap.read("~{input_id}.metrics.h5ad")
-
-        # Calculate and plot the size distribution of fragments
-        print("Calculating fragment size distribution")
-        snap.pl.frag_size_distr(atac_data)
-        print(atac_data)
-
-        # Filter cells -- Need to parameterize 
-        print("Filtering cells")
-        snap.pp.filter_cells(atac_data, min_counts=5000, min_tsse=10, max_counts=100000)
-        print(atac_data)
-       
-        # Create a cell by bin matrix containing insertion counts across genome-wide 500-bp bins.
-        print("Creating cell by bin matrix")
-        atac_data_mod = snap.pp.add_tile_matrix(atac_data, inplace=False)
-        print("set obsm")
-        atac_data_mod.obsm["fragment_paired"] =  atac_data.obsm["fragment_paired"]
-        print("set all uns")
-        for key in atac_data.uns.keys():
-            print("set ",key)
-            atac_data_mod.uns[key] = atac_data.uns[key]
-        print(atac_data_mod)
-       
-        # Feature selection
-        print("Feature selection")
-        snap.pp.select_features(atac_data_mod)
-        print(atac_data_mod)
-        
-        # Run customized scrublet algorithm to identify potential doublets
-        print("Run scrublet to identify potential doublets")
-        snap.pp.scrublet(atac_data_mod)
-        print(atac_data_mod)
-        
-        # Employ spectral embedding for dimensionality reduction
-        print("Employ spectral embedding for dimensionality reduction")
-        snap.tl.spectral(atac_data_mod)
-        print(atac_data_mod)
-            
-        # Filter doublets based on scrublet scores 
-        print("Filter doublets based on scrublet scores")
-        snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.5)
-        print(atac_data_mod)
-        
-        # Perform graph-based clustering to identify cell clusters. 
-        # Build a k-nearest neighbour graph using snap.pp.knn
-        print("Perform knn graph-based clustering to identify cell clusters")
-        snap.pp.knn(atac_data_mod)
-        print(atac_data_mod)
-            
-        # Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph
-        print("Use the Leiden community detection algorithm to identify densely-connected subgraphs/clusters in the graph")
-        snap.tl.leiden(atac_data_mod)
-        print(atac_data_mod)
-        
-        # Create the cell by gene activity matrix
-        print("Create the cell by gene activity matrix")
-        gene_mat = snap.pp.make_gene_matrix(atac_data_mod, gene_anno=atac_gtf)
-        print(atac_data_mod)
-
-        # Normalize the gene matrix
-        print("Normalize the gene matrix")
-        gene_mat.obs['leiden'] = atac_data_mod.obs['leiden']
-        sc.pp.normalize_total(gene_mat)
-        sc.pp.log1p(gene_mat)
-        sc.tl.rank_genes_groups(gene_mat, groupby="leiden", method="wilcoxon")
-            
-        for i in np.unique(gene_mat.obs['leiden']):
-            markers = sc.get.rank_genes_groups_df(gene_mat, group=i).head(7)['names']
-            print(f"Cluster {i}: {', '.join(markers)}")
-
-        print("Peak calling using MACS3")
-        snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=1)
-        
-        print("Convert pl.DataFrame to pandas DataFrame")
-        # Convert pl.DataFrame to pandas DataFrame
-        for key in atac_data_mod.uns.keys():
-          if isinstance(atac_data_mod.uns[key], pl.DataFrame):
-              print(key)
-              atac_data_mod.uns[key] = atac_data_mod.uns[key].to_pandas()
-
-        print("Write into h5ad file")
-        atac_data_mod.write_h5ad("~{input_id}.peaks.h5ad")
-        print("test")
-
     CODE
     
     # sorting the file
@@ -740,6 +652,7 @@ task PeakCalling {
     Int min_counts = 5000
     Int min_tsse = 10
     Int max_counts = 100000
+    Float probability_threshold = 0.5
     # Runtime attributes/docker
     String docker_path
     Int disk_size = 500
@@ -817,7 +730,7 @@ task PeakCalling {
         
     # Filter doublets based on scrublet scores 
     print("Filter doublets based on scrublet scores")
-    snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.5)
+    snap.pp.filter_doublets(atac_data_mod, probability_threshold=probability_threshold)
     print(atac_data_mod)
         
     # Perform graph-based clustering to identify cell clusters. 

From 0689868c2543282088c020bc575c35e594660dad Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Tue, 14 Jan 2025 15:54:40 -0500
Subject: [PATCH 41/91] remove probability_threshold parameterization

---
 pipelines/skylab/atac/atac.wdl | 3 +--
 1 file changed, 1 insertion(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index f9edb0362b..03a5f466e5 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -652,7 +652,6 @@ task PeakCalling {
     Int min_counts = 5000
     Int min_tsse = 10
     Int max_counts = 100000
-    Float probability_threshold = 0.5
     # Runtime attributes/docker
     String docker_path
     Int disk_size = 500
@@ -730,7 +729,7 @@ task PeakCalling {
         
     # Filter doublets based on scrublet scores 
     print("Filter doublets based on scrublet scores")
-    snap.pp.filter_doublets(atac_data_mod, probability_threshold=probability_threshold)
+    snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.5)
     print(atac_data_mod)
         
     # Perform graph-based clustering to identify cell clusters. 

From 32f4b7fb70ffba7c436c1947b1bd846ed065caca Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Tue, 14 Jan 2025 17:39:55 -0500
Subject: [PATCH 42/91] remove repeated line

---
 pipelines/skylab/atac/atac.wdl | 1 -
 1 file changed, 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 03a5f466e5..43b2ad21ec 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -517,7 +517,6 @@ task CreateFragmentFile {
     File bam
     File annotations_gtf
     File chrom_sizes
-    File annotations_gtf
     Boolean preindex
     Int disk_size = 500
     Int mem_size = 64

From fffb2564a740484931853a68127adadcc08f4ac9 Mon Sep 17 00:00:00 2001
From: GitHub Action <action@github.com>
Date: Tue, 14 Jan 2025 22:43:31 +0000
Subject: [PATCH 43/91] Updated pipeline_versions.txt with all pipeline version
 information

---
 pipeline_versions.txt | 56 +++++++++++++++++++++----------------------
 1 file changed, 28 insertions(+), 28 deletions(-)

diff --git a/pipeline_versions.txt b/pipeline_versions.txt
index 5ecffd5530..729f50381e 100644
--- a/pipeline_versions.txt
+++ b/pipeline_versions.txt
@@ -1,40 +1,40 @@
 Pipeline Name	Version	Date of Last Commit
-CheckFingerprint	 1.0.22	2024-10-28 
-RNAWithUMIsPipeline	 1.0.18	2024-11-04 
-AnnotationFiltration	 1.2.7	2024-11-04 
-UltimaGenomicsWholeGenomeGermline	 1.1.2	2024-11-04 
-WholeGenomeGermlineSingleSample	 3.3.3	2024-11-04 
-ExomeGermlineSingleSample	 3.2.3	2024-11-04 
-JointGenotypingByChromosomePartTwo	 1.5.2	2024-11-04 
-JointGenotypingByChromosomePartOne	 1.5.2	2024-11-04 
+ExomeReprocessing	 3.3.3	2024-11-04 
+CramToUnmappedBams	 1.1.3	2024-08-02 
+WholeGenomeReprocessing	 3.3.3	2024-11-04 
+ExternalExomeReprocessing	 3.3.3	2024-11-04 
+ExternalWholeGenomeReprocessing	 2.3.3	2024-11-04 
+UltimaGenomicsJointGenotyping	 1.2.2	2024-11-04 
 ReblockGVCF	 2.3.2	2024-11-04 
+JointGenotypingByChromosomePartOne	 1.5.2	2024-11-04 
+JointGenotypingByChromosomePartTwo	 1.5.2	2024-11-04 
 JointGenotyping	 1.7.2	2024-11-04 
-UltimaGenomicsJointGenotyping	 1.2.2	2024-11-04 
+ExomeGermlineSingleSample	 3.2.3	2024-11-04 
+WholeGenomeGermlineSingleSample	 3.3.3	2024-11-04 
+UltimaGenomicsWholeGenomeGermline	 1.1.2	2024-11-04 
 VariantCalling	 2.2.4	2024-11-04 
-UltimaGenomicsWholeGenomeCramOnly	 1.0.23	2024-11-04 
 GDCWholeGenomeSomaticSingleSample	 1.3.4	2024-11-04 
-BroadInternalRNAWithUMIs	 1.0.36	2024-11-04 
-BroadInternalUltimaGenomics	 1.1.2	2024-11-04 
-BroadInternalArrays	 1.1.14	2024-11-04 
-BroadInternalImputation	 1.1.14	2024-11-04 
-Arrays	 2.6.30	2024-11-04 
+UltimaGenomicsWholeGenomeCramOnly	 1.0.23	2024-11-04 
+IlluminaGenotypingArray	 1.12.24	2024-11-04 
+AnnotationFiltration	 1.2.7	2024-11-04 
+CheckFingerprint	 1.0.22	2024-10-28 
 ValidateChip	 1.16.7	2024-11-04 
-MultiSampleArrays	 1.6.2	2024-08-02 
 Imputation	 1.1.15	2024-11-04 
-IlluminaGenotypingArray	 1.12.24	2024-11-04 
-ExternalWholeGenomeReprocessing	 2.3.3	2024-11-04 
-ExternalExomeReprocessing	 3.3.3	2024-11-04 
-CramToUnmappedBams	 1.1.3	2024-08-02 
-WholeGenomeReprocessing	 3.3.3	2024-11-04 
-ExomeReprocessing	 3.3.3	2024-11-04 
+MultiSampleArrays	 1.6.2	2024-08-02 
+Arrays	 2.6.30	2024-11-04 
+BroadInternalUltimaGenomics	 1.1.2	2024-11-04 
+BroadInternalImputation	 1.1.14	2024-11-04 
+BroadInternalArrays	 1.1.14	2024-11-04 
+BroadInternalRNAWithUMIs	 1.0.36	2024-11-04 
+RNAWithUMIsPipeline	 1.0.18	2024-11-04 
+Multiome	 5.9.3	2024-12-3 
+MultiSampleSmartSeq2SingleNucleus	 2.0.6	2024-11-15 
 BuildIndices	 3.1.0	2024-11-26 
+SlideSeq	 3.4.7	2024-12-3 
+PairedTag	 1.8.4	2024-12-3 
+atac	 2.5.3	2024-11-22 
 scATAC	 1.3.2	2023-08-03 
 snm3C	 4.0.4	2024-08-06 
-Multiome	 5.9.3	2024-12-3 
-PairedTag	 1.8.4	2024-12-3 
-MultiSampleSmartSeq2	 2.2.22	2024-09-11 
-MultiSampleSmartSeq2SingleNucleus	 2.0.6	2024-11-15 
 Optimus	 7.8.4	2024-12-3 
-atac	 2.5.3	2024-11-22 
+MultiSampleSmartSeq2	 2.2.22	2024-09-11 
 SmartSeq2SingleSample	 5.1.21	2024-09-11 
-SlideSeq	 3.4.7	2024-12-3 

From cf2a77b841882fe7bc7dfc96d8eae86c4cdb63ab Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Sun, 19 Jan 2025 13:17:50 -0500
Subject: [PATCH 44/91] add optional parameter

---
 pipelines/skylab/atac/atac.wdl | 20 ++++++++++++--------
 1 file changed, 12 insertions(+), 8 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 43b2ad21ec..43b9e920f0 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -28,6 +28,8 @@ workflow ATAC {
 
     # Option for running files with preindex
     Boolean preindex = false
+    # Option for running peak calling
+    Boolean peak_calling = true
     
     # BWA ref
     File tar_bwa_reference
@@ -71,7 +73,6 @@ workflow ATAC {
     }
   }
 
-
   parameter_meta {
     read1_fastq_gzipped: "read 1 FASTQ file as input for the pipeline, contains read 1 of paired reads"
     read2_fastq_gzipped: "read 2 FASTQ file as input for the pipeline, contains the cellular barcodes corresponding to the reads in the read1 FASTQ and read 3 FASTQ"
@@ -160,15 +161,17 @@ workflow ATAC {
         input_id = input_id
 
     }
-    call PeakCalling {
-      input:
-        bam = BWAPairedEndAlignment.bam_aligned_output,
-        annotations_gtf = annotations_gtf,
-        metrics_h5ad = CreateFragmentFile.Snap_metrics,
-        docker_path = docker_prefix + snap_atac_docker
+    if (peak_calling) {
+      call PeakCalling {
+        input:
+          bam = BWAPairedEndAlignment.bam_aligned_output,
+          annotations_gtf = annotations_gtf,
+          metrics_h5ad = CreateFragmentFile.Snap_metrics,
+          docker_path = docker_prefix + snap_atac_docker
+      }
     }
   }
-
+  
   File bam_aligned_output_atac = select_first([BBTag.bb_bam, BWAPairedEndAlignment.bam_aligned_output])
   File fragment_file_atac = select_first([BB_fragment.fragment_file, CreateFragmentFile.fragment_file])
   File snap_metrics_atac = select_first([BB_fragment.Snap_metrics,CreateFragmentFile.Snap_metrics])
@@ -642,6 +645,7 @@ task CreateFragmentFile {
   }
 }
 
+# peak calling using SnapATAC2
 task PeakCalling {
   input {
     File bam

From cf63ad1f3ca83054941842906efd9c497bb66797 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 21 Jan 2025 10:29:17 -0500
Subject: [PATCH 45/91] add output

---
 pipelines/skylab/atac/atac.wdl | 7 +++++--
 1 file changed, 5 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 43b9e920f0..7941597e50 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -176,12 +176,16 @@ workflow ATAC {
   File fragment_file_atac = select_first([BB_fragment.fragment_file, CreateFragmentFile.fragment_file])
   File snap_metrics_atac = select_first([BB_fragment.Snap_metrics,CreateFragmentFile.Snap_metrics])
   File library_metrics = select_first([BB_fragment.atac_library_metrics, CreateFragmentFile.atac_library_metrics])
-
+  
+  # if peakcalling task not called set peakcall_h5ad to null
+  File peakcall_h5ad = if (peak_calling) PeakCalling.peaks_h5ad else snap_metrics_atac
+  
   output {
     File bam_aligned_output = bam_aligned_output_atac
     File fragment_file = fragment_file_atac
     File snap_metrics = snap_metrics_atac
     File library_metrics_file = library_metrics
+    File peakcall_h5ad_file = peakcall_h5ad
   }
 }
 
@@ -639,7 +643,6 @@ task CreateFragmentFile {
   output {
     File fragment_file = "~{input_id}.fragments.sorted.tsv.gz"
     File fragment_file_index = "~{input_id}.fragments.sorted.tsv.gz.csi"
-
     File Snap_metrics = "~{input_id}.metrics.h5ad"
     File atac_library_metrics = "~{input_id}_~{atac_nhash_id}_library_metrics.csv"
   }

From 5e81613d7a61cc2b3283a7947e7c5ad8548d1d5c Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 21 Jan 2025 10:38:27 -0500
Subject: [PATCH 46/91] add output

---
 pipelines/skylab/atac/atac.wdl | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 0fa2d09aff..9563fd0896 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -178,8 +178,8 @@ workflow ATAC {
   File library_metrics = select_first([BB_fragment.atac_library_metrics, CreateFragmentFile.atac_library_metrics])
   
   # if peakcalling task not called set peakcall_h5ad to null
-  File peakcall_h5ad = if (peak_calling) PeakCalling.peaks_h5ad else snap_metrics_atac
-  
+  File peakcall_h5ad = (if (peak_calling) PeakCalling.peaks_h5ad else snap_metrics_atac)
+
   output {
     File bam_aligned_output = bam_aligned_output_atac
     File fragment_file = fragment_file_atac

From f0216ab5f4d3d0e4418a8afc10970547f6bb8517 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 21 Jan 2025 10:47:10 -0500
Subject: [PATCH 47/91] test

---
 pipelines/skylab/atac/atac.wdl | 7 +++++--
 1 file changed, 5 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 9563fd0896..cbbcbf461f 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -178,8 +178,11 @@ workflow ATAC {
   File library_metrics = select_first([BB_fragment.atac_library_metrics, CreateFragmentFile.atac_library_metrics])
   
   # if peakcalling task not called set peakcall_h5ad to null
-  File peakcall_h5ad = (if (peak_calling) PeakCalling.peaks_h5ad else snap_metrics_atac)
-
+  File peakcall_h5ad = snap_metrics_atac
+  if (peak_calling) {
+    File peakcall_h5ad_file = PeakCalling.peaks_h5ad
+  }
+    
   output {
     File bam_aligned_output = bam_aligned_output_atac
     File fragment_file = fragment_file_atac

From ef09ec90c283d99c78ad6e65678e321e25def90d Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 21 Jan 2025 10:51:46 -0500
Subject: [PATCH 48/91] test

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index cbbcbf461f..fae7e2bf8c 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -180,7 +180,7 @@ workflow ATAC {
   # if peakcalling task not called set peakcall_h5ad to null
   File peakcall_h5ad = snap_metrics_atac
   if (peak_calling) {
-    File peakcall_h5ad_file = PeakCalling.peaks_h5ad
+    File peakcall_h5ad = PeakCalling.peaks_h5ad
   }
     
   output {

From d64ad4dfca29a50140bc916fba78db73258e0cb4 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 21 Jan 2025 12:39:55 -0500
Subject: [PATCH 49/91] test

---
 pipelines/skylab/atac/atac.wdl | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index fae7e2bf8c..c633a348b8 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -180,7 +180,7 @@ workflow ATAC {
   # if peakcalling task not called set peakcall_h5ad to null
   File peakcall_h5ad = snap_metrics_atac
   if (peak_calling) {
-    File peakcall_h5ad = PeakCalling.peaks_h5ad
+     peakcall_h5ad = PeakCalling.peaks_h5ad
   }
     
   output {
@@ -188,7 +188,7 @@ workflow ATAC {
     File fragment_file = fragment_file_atac
     File snap_metrics = snap_metrics_atac
     File library_metrics_file = library_metrics
-    File peakcall_h5ad_file = peakcall_h5ad
+    File? peakcall_h5ad_file = peakcall_h5ad
   }
 }
 

From e3fe25fa55c09f8d5c9a516864c4718b9594ea00 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 21 Jan 2025 12:42:32 -0500
Subject: [PATCH 50/91] test

---
 pipelines/skylab/atac/atac.wdl | 8 +-------
 1 file changed, 1 insertion(+), 7 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index c633a348b8..6a434061d5 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -176,19 +176,13 @@ workflow ATAC {
   File fragment_file_atac = select_first([BB_fragment.fragment_file, CreateFragmentFile.fragment_file])
   File snap_metrics_atac = select_first([BB_fragment.Snap_metrics,CreateFragmentFile.Snap_metrics])
   File library_metrics = select_first([BB_fragment.atac_library_metrics, CreateFragmentFile.atac_library_metrics])
-  
-  # if peakcalling task not called set peakcall_h5ad to null
-  File peakcall_h5ad = snap_metrics_atac
-  if (peak_calling) {
-     peakcall_h5ad = PeakCalling.peaks_h5ad
-  }
     
   output {
     File bam_aligned_output = bam_aligned_output_atac
     File fragment_file = fragment_file_atac
     File snap_metrics = snap_metrics_atac
     File library_metrics_file = library_metrics
-    File? peakcall_h5ad_file = peakcall_h5ad
+    File? peakcall_h5ad_file = PeakCalling.peaks_h5ad
   }
 }
 

From e6dad583dcff51b7470bc7b720988bedbc001f4f Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 21 Jan 2025 12:48:19 -0500
Subject: [PATCH 51/91] test

---
 pipelines/skylab/multiome/Multiome.wdl | 1 +
 1 file changed, 1 insertion(+)

diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
index 1553513fd7..1c2e11f08b 100644
--- a/pipelines/skylab/multiome/Multiome.wdl
+++ b/pipelines/skylab/multiome/Multiome.wdl
@@ -149,6 +149,7 @@ workflow Multiome {
         File fragment_file_index = JoinBarcodes.atac_fragment_tsv_index
         File snap_metrics_atac = JoinBarcodes.atac_h5ad_file
         File atac_library_metrics = Atac.library_metrics_file
+        File? peak_call_atac = Atac.peakcall_h5ad_file
 
         # optimus outputs
         File genomic_reference_version_gex = Optimus.genomic_reference_version

From 80e3fa1cdff2fa339a2ba094cd6ae0a869625eee Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 27 Jan 2025 15:07:36 -0500
Subject: [PATCH 52/91] Added matrix as output

---
 pipelines/skylab/atac/atac.wdl | 11 +++++++++--
 1 file changed, 9 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 6a434061d5..971a98006a 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -167,6 +167,7 @@ workflow ATAC {
           bam = BWAPairedEndAlignment.bam_aligned_output,
           annotations_gtf = annotations_gtf,
           metrics_h5ad = CreateFragmentFile.Snap_metrics,
+          chrom_sizes = chrom_sizes,
           docker_path = docker_prefix + snap_atac_docker
       }
     }
@@ -657,7 +658,8 @@ task PeakCalling {
   input {
     File bam
     File annotations_gtf
-    File metrics_h5ad   
+    File metrics_h5ad  
+    File chrom_sizes
     # SnapATAC2 parameters
     Int min_counts = 5000
     Int min_tsse = 10
@@ -694,6 +696,7 @@ task PeakCalling {
     bam_base_name = "~{bam_base_name}"
     atac_gtf = "~{annotations_gtf}"
     metrics_h5ad = "~{metrics_h5ad}"
+    chrom_sizes = "~{chrom_sizes}"
     min_counts = "~{min_counts}"
     min_tsse = "~{min_tsse}"
     max_counts = "~{max_counts}"
@@ -772,6 +775,9 @@ task PeakCalling {
     print("Peak calling using MACS3")
     snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=1)
     
+    peaks = snap.tl.merge_peaks(atac_data_mod.uns['macs3'], chrom_sizes)
+    peak_matrix = snap.pp.make_peak_matrix(atac_data_mod, use_rep=peaks['Peaks'])
+
     print("Convert pl.DataFrame to pandas DataFrame")
     # Convert pl.DataFrame to pandas DataFrame
     for key in atac_data_mod.uns.keys():
@@ -781,6 +787,7 @@ task PeakCalling {
 
     print("Write into h5ad file")
     atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")
+    peak_matrix.write_h5ad("~{bam_base_name}.matrix.h5ad")
     print("test")
      
     CODE
@@ -795,6 +802,6 @@ task PeakCalling {
 
   output {
     File peaks_h5ad = "~{bam_base_name}.peaks.h5ad"
+    File matrix_h5ad = "~{bam_base_name}.matrix.h5ad"
   }
-
 }

From b3ebae925351d439a84ed1e44675621badd0ffda Mon Sep 17 00:00:00 2001
From: GitHub Action <action@github.com>
Date: Mon, 27 Jan 2025 20:08:33 +0000
Subject: [PATCH 53/91] Updated pipeline_versions.txt with all pipeline version
 information

---
 pipeline_versions.txt | 50 +++++++++++++++++++++----------------------
 1 file changed, 25 insertions(+), 25 deletions(-)

diff --git a/pipeline_versions.txt b/pipeline_versions.txt
index 85b1dbb384..745d09057e 100644
--- a/pipeline_versions.txt
+++ b/pipeline_versions.txt
@@ -1,40 +1,40 @@
 Pipeline Name	Version	Date of Last Commit
-ExomeReprocessing	 3.3.3	2024-11-04 
-CramToUnmappedBams	 1.1.3	2024-08-02 
+IlluminaGenotypingArray	 1.12.24	2024-11-04 
 WholeGenomeReprocessing	 3.3.3	2024-11-04 
-ExternalExomeReprocessing	 3.3.3	2024-11-04 
 ExternalWholeGenomeReprocessing	 2.3.3	2024-11-04 
-UltimaGenomicsJointGenotyping	 1.2.2	2024-11-04 
-ReblockGVCF	 2.4.0	2024-12-05 
-JointGenotypingByChromosomePartOne	 1.5.2	2024-11-04 
-JointGenotypingByChromosomePartTwo	 1.5.2	2024-11-04 
-JointGenotyping	 1.7.2	2024-11-04 
-ExomeGermlineSingleSample	 3.2.3	2024-11-04 
+ExternalExomeReprocessing	 3.3.3	2024-11-04 
+CramToUnmappedBams	 1.1.3	2024-08-02 
+ExomeReprocessing	 3.3.3	2024-11-04 
+GDCWholeGenomeSomaticSingleSample	 1.3.4	2024-11-04 
+UltimaGenomicsWholeGenomeCramOnly	 1.0.23	2024-11-04 
 WholeGenomeGermlineSingleSample	 3.3.3	2024-11-04 
 UltimaGenomicsWholeGenomeGermline	 1.1.3	2024-12-05 
+ExomeGermlineSingleSample	 3.2.3	2024-11-04 
+JointGenotyping	 1.7.2	2024-11-04 
+ReblockGVCF	 2.4.0	2024-12-05 
+UltimaGenomicsJointGenotyping	 1.2.2	2024-11-04 
+JointGenotypingByChromosomePartTwo	 1.5.2	2024-11-04 
+JointGenotypingByChromosomePartOne	 1.5.2	2024-11-04 
 VariantCalling	 2.2.4	2024-11-04 
-GDCWholeGenomeSomaticSingleSample	 1.3.4	2024-11-04 
-UltimaGenomicsWholeGenomeCramOnly	 1.0.23	2024-11-04 
-IlluminaGenotypingArray	 1.12.24	2024-11-04 
-AnnotationFiltration	 1.2.7	2024-11-04 
 CheckFingerprint	 1.0.22	2024-10-28 
-ValidateChip	 1.16.7	2024-11-04 
-Imputation	 1.1.15	2024-11-04 
-MultiSampleArrays	 1.6.2	2024-08-02 
-Arrays	 2.6.30	2024-11-04 
+RNAWithUMIsPipeline	 1.0.18	2024-11-04 
 BroadInternalUltimaGenomics	 1.1.3	2024-12-05 
+BroadInternalRNAWithUMIs	 1.0.36	2024-11-04 
 BroadInternalImputation	 1.1.14	2024-11-04 
 BroadInternalArrays	 1.1.14	2024-11-04 
-BroadInternalRNAWithUMIs	 1.0.36	2024-11-04 
-RNAWithUMIsPipeline	 1.0.18	2024-11-04 
+Imputation	 1.1.15	2024-11-04 
+MultiSampleArrays	 1.6.2	2024-08-02 
+ValidateChip	 1.16.7	2024-11-04 
+Arrays	 2.6.30	2024-11-04 
+AnnotationFiltration	 1.2.7	2024-11-04 
 Multiome	 5.9.6	2025-01-21 
-MultiSampleSmartSeq2SingleNucleus	 2.0.7	2025-01-13 
-BuildIndices	 4.0.0	2025-01-17 
+snm3C	 4.0.4	2024-08-06 
 SlideSeq	 3.4.8	2025-01-13 
-PairedTag	 1.10.0	2025-01-21 
-atac	 2.6.0	2025-01-21 
 scATAC	 1.3.2	2023-08-03 
-snm3C	 4.0.4	2024-08-06 
-Optimus	 7.9.1	2025-01-13 
+BuildIndices	 4.0.0	2025-01-17 
 MultiSampleSmartSeq2	 2.2.22	2024-09-11 
+Optimus	 7.9.1	2025-01-13 
+atac	 2.6.0	2025-01-21 
+PairedTag	 1.10.0	2025-01-21 
 SmartSeq2SingleSample	 5.1.21	2024-09-11 
+MultiSampleSmartSeq2SingleNucleus	 2.0.7	2025-01-13 

From 9e4916aaab19ee0e45aae955efb18aa24fbaaccc Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 27 Jan 2025 15:09:32 -0500
Subject: [PATCH 54/91] Added matrix as output

---
 pipelines/skylab/atac/atac.wdl | 2 ++
 1 file changed, 2 insertions(+)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index e159a9c855..4883a27ec7 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -777,8 +777,10 @@ task PeakCalling {
     print("Peak calling using MACS3")
     snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=1)
     
+    print("Merge peaks and create peak matrix")
     peaks = snap.tl.merge_peaks(atac_data_mod.uns['macs3'], chrom_sizes)
     peak_matrix = snap.pp.make_peak_matrix(atac_data_mod, use_rep=peaks['Peaks'])
+    print(type(peak_matrix))
 
     print("Convert pl.DataFrame to pandas DataFrame")
     # Convert pl.DataFrame to pandas DataFrame

From cd7c100633351128395c08ef27824137621be851 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 27 Jan 2025 16:23:21 -0500
Subject: [PATCH 55/91] Added matrix as output

---
 pipelines/skylab/atac/atac.wdl | 6 +++++-
 1 file changed, 5 insertions(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 4883a27ec7..bfce85f386 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -778,7 +778,11 @@ task PeakCalling {
     snap.tl.macs3(atac_data_mod, groupby='leiden', n_jobs=1)
     
     print("Merge peaks and create peak matrix")
-    peaks = snap.tl.merge_peaks(atac_data_mod.uns['macs3'], chrom_sizes)
+    # read chrom sizes
+    chromsize_dict = pd.read_csv(chrom_sizes, sep='\t', header=None)
+    chromsize_dict = pd.Series(mouse_chromsize[1].values, index=mouse_chromsize[0]).to_dict()
+    # merge peaks and create peak matrix
+    peaks = snap.tl.merge_peaks(atac_data_mod.uns['macs3'], chromsize_dict)
     peak_matrix = snap.pp.make_peak_matrix(atac_data_mod, use_rep=peaks['Peaks'])
     print(type(peak_matrix))
 

From d7486d98999f120cf41d230d5a16e3e79c54bf06 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 28 Jan 2025 07:34:42 -0500
Subject: [PATCH 56/91] test

---
 pipelines/skylab/atac/atac.wdl | 1 +
 1 file changed, 1 insertion(+)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index bfce85f386..75a38c0010 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -693,6 +693,7 @@ task PeakCalling {
     import scanpy as sc
     import numpy as np
     import polars as pl
+    import pandas as pd
 
     bam = "~{bam}"
     bam_base_name = "~{bam_base_name}"

From 89824b03c9606c6cef4212dcb19ea7091c062251 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 28 Jan 2025 08:23:12 -0500
Subject: [PATCH 57/91] test

---
 pipelines/skylab/atac/atac.wdl | 4 +++-
 1 file changed, 3 insertions(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 75a38c0010..35a2676e58 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -781,11 +781,13 @@ task PeakCalling {
     print("Merge peaks and create peak matrix")
     # read chrom sizes
     chromsize_dict = pd.read_csv(chrom_sizes, sep='\t', header=None)
-    chromsize_dict = pd.Series(mouse_chromsize[1].values, index=mouse_chromsize[0]).to_dict()
+    chromsize_dict = pd.Series(chromsize_dict[1].values, index=chromsize_dict[0]).to_dict()
     # merge peaks and create peak matrix
     peaks = snap.tl.merge_peaks(atac_data_mod.uns['macs3'], chromsize_dict)
+    print(peaks)
     peak_matrix = snap.pp.make_peak_matrix(atac_data_mod, use_rep=peaks['Peaks'])
     print(type(peak_matrix))
+    print(peak_matrix)
 
     print("Convert pl.DataFrame to pandas DataFrame")
     # Convert pl.DataFrame to pandas DataFrame

From aee56ecf1b720d32e7b34144875a0c1d957ed51b Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 28 Jan 2025 14:09:37 -0500
Subject: [PATCH 58/91] remove comments

---
 pipelines/skylab/atac/atac.wdl | 3 ---
 1 file changed, 3 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 35a2676e58..4ad785eeec 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -784,10 +784,7 @@ task PeakCalling {
     chromsize_dict = pd.Series(chromsize_dict[1].values, index=chromsize_dict[0]).to_dict()
     # merge peaks and create peak matrix
     peaks = snap.tl.merge_peaks(atac_data_mod.uns['macs3'], chromsize_dict)
-    print(peaks)
     peak_matrix = snap.pp.make_peak_matrix(atac_data_mod, use_rep=peaks['Peaks'])
-    print(type(peak_matrix))
-    print(peak_matrix)
 
     print("Convert pl.DataFrame to pandas DataFrame")
     # Convert pl.DataFrame to pandas DataFrame

From 83fbe0506f19cf58211e5bf38ed112e5ed74cd52 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 31 Jan 2025 09:46:05 -0500
Subject: [PATCH 59/91] update changelogs/versions

---
 pipelines/skylab/atac/atac.changelog.md            | 4 ++++
 pipelines/skylab/atac/atac.wdl                     | 2 +-
 pipelines/skylab/multiome/Multiome.changelog.md    | 4 ++++
 pipelines/skylab/multiome/Multiome.wdl             | 7 +++++--
 pipelines/skylab/paired_tag/PairedTag.changelog.md | 4 ++++
 pipelines/skylab/paired_tag/PairedTag.wdl          | 2 +-
 6 files changed, 19 insertions(+), 4 deletions(-)

diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md
index d47665f255..8145cb8761 100644
--- a/pipelines/skylab/atac/atac.changelog.md
+++ b/pipelines/skylab/atac/atac.changelog.md
@@ -1,3 +1,7 @@
+# 2.6.1
+2025-01-31 (Date of Last Commit)
+* Added an optional PeakCalling task. Added a boolean variable run_peak_calling; default is false. 
+
 # 2.6.0
 2025-01-21 (Date of Last Commit)
 
diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 4ad785eeec..47383df63a 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -51,7 +51,7 @@ workflow ATAC {
     String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
   }
 
-  String pipeline_version = "2.6.0"
+  String pipeline_version = "2.6.1"
 
   # Determine docker prefix based on cloud provider
   String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/"
diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md
index c73565dbbc..e870007734 100644
--- a/pipelines/skylab/multiome/Multiome.changelog.md
+++ b/pipelines/skylab/multiome/Multiome.changelog.md
@@ -1,3 +1,7 @@
+# 5.9.7
+2025-01-31 (Date of Last Commit)
+* Added an optional PeakCalling task to the ATAC workflow. Added a boolean variable run_peak_calling to the Multiome pipeline; default is false. 
+
 # 5.9.6
 2025-01-21 (Date of Last Commit)
 
diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
index 6cf6b92e4e..d6d97a0f84 100644
--- a/pipelines/skylab/multiome/Multiome.wdl
+++ b/pipelines/skylab/multiome/Multiome.wdl
@@ -7,7 +7,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow Multiome {
 
-    String pipeline_version = "5.9.6"
+    String pipeline_version = "5.9.7"
 
     input {
         String cloud_provider
@@ -50,6 +50,8 @@ workflow Multiome {
 
         # CellBender
         Boolean run_cellbender = false
+        # Peak Calling
+        Boolean run_peak_calling = false
     }
 
     # Determine docker prefix based on cloud provider
@@ -121,7 +123,8 @@ workflow Multiome {
             annotations_gtf = annotations_gtf,
             atac_nhash_id = atac_nhash_id,
             adapter_seq_read3 = adapter_seq_read3,
-            atac_expected_cells = expected_cells
+            atac_expected_cells = expected_cells,
+            peak_calling = run_peak_calling
     }
     call H5adUtils.JoinMultiomeBarcodes as JoinBarcodes {
         input:
diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md
index d26db399ff..1bc923a3cd 100644
--- a/pipelines/skylab/paired_tag/PairedTag.changelog.md
+++ b/pipelines/skylab/paired_tag/PairedTag.changelog.md
@@ -1,3 +1,7 @@
+# 1.10.1
+2025-01-31 (Date of Last Commit)
+* Added an optional PeakCalling task to the ATAC workflow. Added a boolean variable run_peak_calling to the Multiome pipeline; default is false. This does not affect the outputs of the pipeline
+
 # 1.10.0
 2025-01-21 (Date of Last Commit)
 
diff --git a/pipelines/skylab/paired_tag/PairedTag.wdl b/pipelines/skylab/paired_tag/PairedTag.wdl
index fdf942bf90..05d1b74b96 100644
--- a/pipelines/skylab/paired_tag/PairedTag.wdl
+++ b/pipelines/skylab/paired_tag/PairedTag.wdl
@@ -8,7 +8,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow PairedTag {
 
-    String pipeline_version = "1.10.0"
+    String pipeline_version = "1.10.1"
 
 
     input {

From a0dd316c26238a85928eaa8f7164c2e881d8bf73 Mon Sep 17 00:00:00 2001
From: GitHub Action <action@github.com>
Date: Fri, 31 Jan 2025 14:46:42 +0000
Subject: [PATCH 60/91] Updated pipeline_versions.txt with all pipeline version
 information

---
 pipeline_versions.txt | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/pipeline_versions.txt b/pipeline_versions.txt
index 745d09057e..f2cfe20fed 100644
--- a/pipeline_versions.txt
+++ b/pipeline_versions.txt
@@ -27,14 +27,14 @@ MultiSampleArrays	 1.6.2	2024-08-02
 ValidateChip	 1.16.7	2024-11-04 
 Arrays	 2.6.30	2024-11-04 
 AnnotationFiltration	 1.2.7	2024-11-04 
-Multiome	 5.9.6	2025-01-21 
+Multiome	 5.9.7	2025-01-31 
 snm3C	 4.0.4	2024-08-06 
 SlideSeq	 3.4.8	2025-01-13 
 scATAC	 1.3.2	2023-08-03 
 BuildIndices	 4.0.0	2025-01-17 
 MultiSampleSmartSeq2	 2.2.22	2024-09-11 
 Optimus	 7.9.1	2025-01-13 
-atac	 2.6.0	2025-01-21 
-PairedTag	 1.10.0	2025-01-21 
+atac	 2.6.1	2025-01-31 
+PairedTag	 1.10.1	2025-01-31 
 SmartSeq2SingleSample	 5.1.21	2024-09-11 
 MultiSampleSmartSeq2SingleNucleus	 2.0.7	2025-01-13 

From 56806372f6c297f2a1664399226eb1a22763f9d4 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 31 Jan 2025 14:35:16 -0500
Subject: [PATCH 61/91] documenation

---
 website/docs/Pipelines/ATAC/README.md              | 8 ++++++--
 website/docs/Pipelines/Multiome_Pipeline/README.md | 1 +
 2 files changed, 7 insertions(+), 2 deletions(-)

diff --git a/website/docs/Pipelines/ATAC/README.md b/website/docs/Pipelines/ATAC/README.md
index 86d3eaab3e..2651b080f4 100644
--- a/website/docs/Pipelines/ATAC/README.md
+++ b/website/docs/Pipelines/ATAC/README.md
@@ -65,6 +65,7 @@ The following describes the inputs of the ATAC workflow. For more details on how
 | adapter_seq_read3 | TrimAdapters input: Sequence adapter for read 3 fastq. |
 | vm_size | String defining the Azure virtual machine family for the workflow (default: "Standard_M128s"). 
 | atac_nhash_id | String that represents an optional library aliquot identifier. When used, it is echoed in the h5ad unstructured data. |
+| peak_calling | Optional boolean used to determine if the ATAC pipeline should run Peak Calling; default is "false".  | Boolean |
 
 ## ATAC tasks and tools
 
@@ -86,7 +87,7 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | [TrimAdapters](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | Cutadapt v4.4 | cutadapt | Trims adaptor sequences. |
 | [BWAPairedEndAlignment](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | bwa-mem2 | mem | Aligns reads from each set of partitioned FASTQ files to the genome and outputs a BAM with ATAC barcodes in the CB:Z tag. |
 | [CreateFragmentFile](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | make_fragment_file, import_data | SnapATAC2 | Generates a fragment file from the final aligned BAM and outputs per barcode quality metrics in h5ad. A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
-
+| [PeakCalling](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | macs3 | SnapATAC2 | Generates two h5ad files (`peaks.h5ad` and `matrix.h5ad`) from the CreateFragmentFile h5ad output file (`metrics.h5ad`). The `peaks.h5ad` contains the peak called per cluster in the macs3 unstructured metadata and `matrix.h5ad` contains the merged peaks and the count matrix of peaks per fragment. A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
 
 ## Output variables
 
@@ -95,7 +96,10 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | bam_aligned_output | `<input_id>`.bam | BAM containing aligned reads from ATAC workflow. |
 | fragment_file | `<input_id>`.fragments.sorted.tsv.gz | Bgzipped TSV containing fragment start and stop coordinates per barcode. In order, the columns are "Chromosome", "Start", "Stop", "ATAC Barcode", and "Number Reads". | 
 | snap_metrics | `<input_id`.metrics.h5ad | h5ad (Anndata) containing per barcode metrics from [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
- library_metrics | `<input_id>`_`<atac_nhash_id>_library_metrics.csv | CSV file containing library-level metrics. Read more in the [Library Metrics Overview](library-metrics.md)
+ library_metrics | `<input_id>`_`<atac_nhash_id>_library_metrics.csv | CSV file containing library-level metrics. Read more in the [Library Metrics Overview](library-metrics.md) |
+| snap_peaks | `<input_id`.peaks.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
+| snap_matrix | `<input_id`.matrix.h5ad | h5ad (Anndata) containing per merged peaks (called by MACS3) per cluster and count matrix of peaks per fragment [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). 
+
 
 ## Versioning and testing
 
diff --git a/website/docs/Pipelines/Multiome_Pipeline/README.md b/website/docs/Pipelines/Multiome_Pipeline/README.md
index 131a81aca5..7e91d9f7e9 100644
--- a/website/docs/Pipelines/Multiome_Pipeline/README.md
+++ b/website/docs/Pipelines/Multiome_Pipeline/README.md
@@ -82,6 +82,7 @@ Multiome can be deployed using [Cromwell](https://cromwell.readthedocs.io/en/sta
 | adapter_seq_read1 | Optional string describing the adapter sequence for ATAC read 1 paired-end reads to be used during adapter trimming with Cutadapt; default is "GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG". | String |
 | adapter_seq_read3 | Optional string describing the adapter sequence for ATAC read 2 paired-end reads to be used during adapter trimming with Cutadapt; default is "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG". | String |
 | run_cellbender | Optional boolean used to determine if the Optimus (GEX) pipeline should run CellBender on the output gene expression h5ad file, `h5ad_output_file_gex`; default is "false".  | Boolean |
+| run_peak_calling | Optional boolean used to determine if the ATAC pipeline should run Peak Calling; default is "false".  | Boolean |
 | vm_size | String defining the Azure virtual machine family for the workflow (default: "Standard_M128s"). | String |
 
 

From 745d9c40389fa7f5ddb9894abbc62eb20bfe68f0 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 31 Jan 2025 14:46:47 -0500
Subject: [PATCH 62/91] rename

---
 pipelines/skylab/atac/atac.wdl        | 9 ++++-----
 website/docs/Pipelines/ATAC/README.md | 7 +++----
 2 files changed, 7 insertions(+), 9 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 47383df63a..ff34a7239d 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -794,9 +794,8 @@ task PeakCalling {
           atac_data_mod.uns[key] = atac_data_mod.uns[key].to_pandas()
 
     print("Write into h5ad file")
-    atac_data_mod.write_h5ad("~{bam_base_name}.peaks.h5ad")
-    peak_matrix.write_h5ad("~{bam_base_name}.matrix.h5ad")
-    print("test")
+    atac_data_mod.write_h5ad("~{bam_base_name}.cellbybin.h5ad")
+    peak_matrix.write_h5ad("~{bam_base_name}.cellbypeak.h5ad")
      
     CODE
   >>>
@@ -809,7 +808,7 @@ task PeakCalling {
   }
 
   output {
-    File peaks_h5ad = "~{bam_base_name}.peaks.h5ad"
-    File matrix_h5ad = "~{bam_base_name}.matrix.h5ad"
+    File peaks_h5ad = "~{bam_base_name}.cellbybin.h5ad"
+    File matrix_h5ad = "~{bam_base_name}.cellbypeak.h5ad"
   }
 }
diff --git a/website/docs/Pipelines/ATAC/README.md b/website/docs/Pipelines/ATAC/README.md
index 2651b080f4..f3d7bc6767 100644
--- a/website/docs/Pipelines/ATAC/README.md
+++ b/website/docs/Pipelines/ATAC/README.md
@@ -87,7 +87,7 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | [TrimAdapters](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | Cutadapt v4.4 | cutadapt | Trims adaptor sequences. |
 | [BWAPairedEndAlignment](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | bwa-mem2 | mem | Aligns reads from each set of partitioned FASTQ files to the genome and outputs a BAM with ATAC barcodes in the CB:Z tag. |
 | [CreateFragmentFile](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | make_fragment_file, import_data | SnapATAC2 | Generates a fragment file from the final aligned BAM and outputs per barcode quality metrics in h5ad. A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
-| [PeakCalling](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | macs3 | SnapATAC2 | Generates two h5ad files (`peaks.h5ad` and `matrix.h5ad`) from the CreateFragmentFile h5ad output file (`metrics.h5ad`). The `peaks.h5ad` contains the peak called per cluster in the macs3 unstructured metadata and `matrix.h5ad` contains the merged peaks and the count matrix of peaks per fragment. A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
+| [PeakCalling](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | macs3 | SnapATAC2 | Generates two h5ad files (`cellbybin.h5ad` and `cellbypeak.h5ad`) from the CreateFragmentFile h5ad output file (`metrics.h5ad`). The `peaks.h5ad` contains the peak called per cluster in the macs3 unstructured metadata and `matrix.h5ad` contains the merged peaks and the count matrix of peaks per fragment. A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
 
 ## Output variables
 
@@ -97,9 +97,8 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | fragment_file | `<input_id>`.fragments.sorted.tsv.gz | Bgzipped TSV containing fragment start and stop coordinates per barcode. In order, the columns are "Chromosome", "Start", "Stop", "ATAC Barcode", and "Number Reads". | 
 | snap_metrics | `<input_id`.metrics.h5ad | h5ad (Anndata) containing per barcode metrics from [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
  library_metrics | `<input_id>`_`<atac_nhash_id>_library_metrics.csv | CSV file containing library-level metrics. Read more in the [Library Metrics Overview](library-metrics.md) |
-| snap_peaks | `<input_id`.peaks.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
-| snap_matrix | `<input_id`.matrix.h5ad | h5ad (Anndata) containing per merged peaks (called by MACS3) per cluster and count matrix of peaks per fragment [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). 
-
+| snap_peaks | `<input_id`.cellbybin.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
+| snap_matrix | `<input_id`.cellbypeak.h5ad | h5ad (Anndata) containing per merged peaks (called by MACS3) per cluster and count matrix of peaks per fragment [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). 
 
 ## Versioning and testing
 

From 54694bcda78ba159f9bc2f5d9686d19efca9bbd1 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 31 Jan 2025 14:59:44 -0500
Subject: [PATCH 63/91] rename

---
 pipelines/skylab/atac/atac.wdl | 14 ++++++--------
 1 file changed, 6 insertions(+), 8 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index ff34a7239d..3ed3228f25 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -658,7 +658,6 @@ task CreateFragmentFile {
 # peak calling using SnapATAC2
 task PeakCalling {
   input {
-    File bam
     File annotations_gtf
     File metrics_h5ad  
     File chrom_sizes
@@ -672,7 +671,7 @@ task PeakCalling {
     Int mem_size = 64
     Int nthreads = 4   
   }
-  String bam_base_name = basename(bam, ".bam")
+  String base_name = basename(metrics_h5ad, ".h5ad")
   
   parameter_meta {
     bam: "Aligned bam with CB in CB tag. This is the output of the BWAPairedEndAlignment task."
@@ -695,8 +694,7 @@ task PeakCalling {
     import polars as pl
     import pandas as pd
 
-    bam = "~{bam}"
-    bam_base_name = "~{bam_base_name}"
+    base_name = "~{base_name}"
     atac_gtf = "~{annotations_gtf}"
     metrics_h5ad = "~{metrics_h5ad}"
     chrom_sizes = "~{chrom_sizes}"
@@ -794,8 +792,8 @@ task PeakCalling {
           atac_data_mod.uns[key] = atac_data_mod.uns[key].to_pandas()
 
     print("Write into h5ad file")
-    atac_data_mod.write_h5ad("~{bam_base_name}.cellbybin.h5ad")
-    peak_matrix.write_h5ad("~{bam_base_name}.cellbypeak.h5ad")
+    atac_data_mod.write_h5ad("~{base_name}.cellbybin.h5ad")
+    peak_matrix.write_h5ad("~{base_name}.cellbypeak.h5ad")
      
     CODE
   >>>
@@ -808,7 +806,7 @@ task PeakCalling {
   }
 
   output {
-    File peaks_h5ad = "~{bam_base_name}.cellbybin.h5ad"
-    File matrix_h5ad = "~{bam_base_name}.cellbypeak.h5ad"
+    File peaks_h5ad = "~{base_name}.cellbybin.h5ad"
+    File matrix_h5ad = "~{base_name}.cellbypeak.h5ad"
   }
 }

From c664618367be41e10d321cb859a8115c7a5cfbc0 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 31 Jan 2025 15:05:35 -0500
Subject: [PATCH 64/91] rename

---
 pipelines/skylab/atac/atac.wdl | 15 ++++++++-------
 1 file changed, 8 insertions(+), 7 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 3ed3228f25..98c1a5b990 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -661,6 +661,8 @@ task PeakCalling {
     File annotations_gtf
     File metrics_h5ad  
     File chrom_sizes
+    String output_base_name
+
     # SnapATAC2 parameters
     Int min_counts = 5000
     Int min_tsse = 10
@@ -671,7 +673,6 @@ task PeakCalling {
     Int mem_size = 64
     Int nthreads = 4   
   }
-  String base_name = basename(metrics_h5ad, ".h5ad")
   
   parameter_meta {
     bam: "Aligned bam with CB in CB tag. This is the output of the BWAPairedEndAlignment task."
@@ -694,7 +695,7 @@ task PeakCalling {
     import polars as pl
     import pandas as pd
 
-    base_name = "~{base_name}"
+    base_name = "~{output_base_name}"
     atac_gtf = "~{annotations_gtf}"
     metrics_h5ad = "~{metrics_h5ad}"
     chrom_sizes = "~{chrom_sizes}"
@@ -710,7 +711,7 @@ task PeakCalling {
     snap.pl.frag_size_distr(atac_data)
     print(atac_data)
 
-    # Filter cells -- Need to parameterize 
+    # Filter cells
     print("Filtering cells")
     snap.pp.filter_cells(atac_data, min_counts=min_counts, min_tsse=min_tsse, max_counts=max_counts)
     print(atac_data)
@@ -792,8 +793,8 @@ task PeakCalling {
           atac_data_mod.uns[key] = atac_data_mod.uns[key].to_pandas()
 
     print("Write into h5ad file")
-    atac_data_mod.write_h5ad("~{base_name}.cellbybin.h5ad")
-    peak_matrix.write_h5ad("~{base_name}.cellbypeak.h5ad")
+    atac_data_mod.write_h5ad("~{output_base_name}.cellbybin.h5ad")
+    peak_matrix.write_h5ad("~{output_base_name}.cellbypeak.h5ad")
      
     CODE
   >>>
@@ -806,7 +807,7 @@ task PeakCalling {
   }
 
   output {
-    File peaks_h5ad = "~{base_name}.cellbybin.h5ad"
-    File matrix_h5ad = "~{base_name}.cellbypeak.h5ad"
+    File peaks_h5ad = "~{output_base_name}.cellbybin.h5ad"
+    File matrix_h5ad = "~{output_base_name}.cellbypeak.h5ad"
   }
 }

From 328ec9a0362f819317ece5d111d2941dd6f33359 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Fri, 31 Jan 2025 15:24:02 -0500
Subject: [PATCH 65/91] rename

---
 pipelines/skylab/atac/atac.wdl | 5 ++---
 1 file changed, 2 insertions(+), 3 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 98c1a5b990..10cfb5af66 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -164,7 +164,6 @@ workflow ATAC {
     if (peak_calling) {
       call PeakCalling {
         input:
-          bam = BWAPairedEndAlignment.bam_aligned_output,
           annotations_gtf = annotations_gtf,
           metrics_h5ad = CreateFragmentFile.Snap_metrics,
           chrom_sizes = chrom_sizes,
@@ -793,8 +792,8 @@ task PeakCalling {
           atac_data_mod.uns[key] = atac_data_mod.uns[key].to_pandas()
 
     print("Write into h5ad file")
-    atac_data_mod.write_h5ad("~{output_base_name}.cellbybin.h5ad")
-    peak_matrix.write_h5ad("~{output_base_name}.cellbypeak.h5ad")
+    atac_data_mod.write_h5ad("~{base_name}.cellbybin.h5ad")
+    peak_matrix.write_h5ad("~{base_name}.cellbypeak.h5ad")
      
     CODE
   >>>

From 3ee54aa9024aa09624c9486ac86f9c4f1b2c02d9 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 09:18:47 -0500
Subject: [PATCH 66/91] fix

---
 pipelines/skylab/atac/atac.wdl | 10 +++++-----
 1 file changed, 5 insertions(+), 5 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 10cfb5af66..d6c3d29579 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -694,7 +694,7 @@ task PeakCalling {
     import polars as pl
     import pandas as pd
 
-    base_name = "~{output_base_name}"
+    output_base_name = "~{output_base_name}"
     atac_gtf = "~{annotations_gtf}"
     metrics_h5ad = "~{metrics_h5ad}"
     chrom_sizes = "~{chrom_sizes}"
@@ -792,8 +792,8 @@ task PeakCalling {
           atac_data_mod.uns[key] = atac_data_mod.uns[key].to_pandas()
 
     print("Write into h5ad file")
-    atac_data_mod.write_h5ad("~{base_name}.cellbybin.h5ad")
-    peak_matrix.write_h5ad("~{base_name}.cellbypeak.h5ad")
+    atac_data_mod.write_h5ad("~{output_base_name}.cellbybin.h5ad")
+    peak_matrix.write_h5ad("~{output_base_name}.cellbypeak.h5ad")
      
     CODE
   >>>
@@ -806,7 +806,7 @@ task PeakCalling {
   }
 
   output {
-    File peaks_h5ad = "~{output_base_name}.cellbybin.h5ad"
-    File matrix_h5ad = "~{output_base_name}.cellbypeak.h5ad"
+    File cellbybin_h5ad = "~{output_base_name}.cellbybin.h5ad"
+    File cellbypeak_h5ad = "~{output_base_name}.cellbypeak.h5ad"
   }
 }

From a3e99ceeb37a10547f9eb9c54fc4a7a936b75501 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 09:20:28 -0500
Subject: [PATCH 67/91] fix

---
 pipelines/skylab/atac/atac.wdl | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index d6c3d29579..9b62bf376c 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -184,7 +184,8 @@ workflow ATAC {
     File fragment_file_index = fragment_file_index_atac
     File snap_metrics = snap_metrics_atac
     File library_metrics_file = library_metrics
-    File? peakcall_h5ad_file = PeakCalling.peaks_h5ad
+    File? cellbybin_h5ad_file = PeakCalling.cellbybin_h5ad
+    File? cellbypeak_h5ad_file = PeakCalling.cellbypeak_h5ad
   }
 }
 

From 581d03923eed61a02edbeb6d86850fef8ab6e346 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 09:32:14 -0500
Subject: [PATCH 68/91] fix

---
 pipelines/skylab/atac/atac.wdl | 1 +
 1 file changed, 1 insertion(+)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 9b62bf376c..d87c770279 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -164,6 +164,7 @@ workflow ATAC {
     if (peak_calling) {
       call PeakCalling {
         input:
+          output_base_name = input_id,
           annotations_gtf = annotations_gtf,
           metrics_h5ad = CreateFragmentFile.Snap_metrics,
           chrom_sizes = chrom_sizes,

From b5f0d2fa17eef716fe7a501bfc2051557c64e1bc Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 09:45:51 -0500
Subject: [PATCH 69/91] fix

---
 pipelines/skylab/multiome/Multiome.wdl | 3 ++-
 1 file changed, 2 insertions(+), 1 deletion(-)

diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
index d6d97a0f84..46056dae5d 100644
--- a/pipelines/skylab/multiome/Multiome.wdl
+++ b/pipelines/skylab/multiome/Multiome.wdl
@@ -152,7 +152,8 @@ workflow Multiome {
         File fragment_file_index = JoinBarcodes.atac_fragment_tsv_index
         File snap_metrics_atac = JoinBarcodes.atac_h5ad_file
         File atac_library_metrics = Atac.library_metrics_file
-        File? peak_call_atac = Atac.peakcall_h5ad_file
+        File? cellbybin_h5ad_file = Atac.cellbybin_h5ad_file
+        File? cellbypeak_h5ad_file = Atac.cellbypeak_h5ad_file
 
         # optimus outputs
         File genomic_reference_version_gex = Optimus.genomic_reference_version

From 9ca0202f39d0243ecf3d13bb2b79b671cb9523a4 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 09:46:37 -0500
Subject: [PATCH 70/91] fix

---
 pipelines/skylab/atac/atac.wdl | 1 -
 1 file changed, 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index d87c770279..f3c00516f8 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -676,7 +676,6 @@ task PeakCalling {
   }
   
   parameter_meta {
-    bam: "Aligned bam with CB in CB tag. This is the output of the BWAPairedEndAlignment task."
     annotations_gtf: "GTF for SnapATAC2 to calculate TSS sites of fragment file."
     disk_size: "Disk size used in create fragment file step."
     mem_size: "The size of memory used in create fragment file."

From d7b84de2c8ac52fbf5baf2047abff49f9c08f964 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 10:56:27 -0500
Subject: [PATCH 71/91] fix

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index f3c00516f8..2001fc875b 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -29,7 +29,7 @@ workflow ATAC {
     # Option for running files with preindex
     Boolean preindex = false
     # Option for running peak calling
-    Boolean peak_calling = true
+    Boolean peak_calling = false
     
     # BWA ref
     File tar_bwa_reference

From e699564c217ccd99d5be0ec311317af99c07c590 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 11:05:21 -0500
Subject: [PATCH 72/91] add peak call json

---
 .../10k_pbmc_downsampled_peakcall.json        | 31 +++++++++++++++++++
 1 file changed, 31 insertions(+)
 create mode 100644 pipelines/skylab/multiome/test_inputs/Plumbing/10k_pbmc_downsampled_peakcall.json

diff --git a/pipelines/skylab/multiome/test_inputs/Plumbing/10k_pbmc_downsampled_peakcall.json b/pipelines/skylab/multiome/test_inputs/Plumbing/10k_pbmc_downsampled_peakcall.json
new file mode 100644
index 0000000000..a567f330b8
--- /dev/null
+++ b/pipelines/skylab/multiome/test_inputs/Plumbing/10k_pbmc_downsampled_peakcall.json
@@ -0,0 +1,31 @@
+{
+  "Multiome.annotations_gtf":"gs://gcp-public-data--broad-references/hg38/v0/star/v2_7_10a/modified_v43.annotation.gtf",
+  "Multiome.input_id":"10k_PBMC_downsampled",
+  "Multiome.cloud_provider":"gcp",
+  "Multiome.gex_r1_fastq":[
+    "gs://broad-gotc-test-storage/Multiome/input/plumbing/fastq_R1_gex.fastq.gz"
+  ],
+  "Multiome.gex_r2_fastq":[
+    "gs://broad-gotc-test-storage/Multiome/input/plumbing/fastq_R2_gex.fastq.gz"
+  ],
+  "Multiome.atac_r1_fastq":[
+    "gs://broad-gotc-test-storage/Multiome/input/plumbing/fastq_R1_atac.fastq.gz"
+  ],
+  "Multiome.atac_r2_fastq":[
+    "gs://broad-gotc-test-storage/Multiome/input/plumbing/fastq_R2_atac.fastq.gz"
+  ],
+  "Multiome.atac_r3_fastq":[
+    "gs://broad-gotc-test-storage/Multiome/input/plumbing/fastq_R3_atac.fastq.gz"
+  ],
+  "Multiome.tar_bwa_reference":"gs://gcp-public-data--broad-references/hg38/v0/bwa/v2_2_1/bwa-mem2-2.2.1-Human-GENCODE-build-GRCh38.tar",
+  "Multiome.tar_star_reference":"gs://gcp-public-data--broad-references/hg38/v0/star/v2_7_10a/modified_star2.7.10a-Human-GENCODE-build-GRCh38-43.tar",
+  "Multiome.chrom_sizes":"gs://broad-gotc-test-storage/Multiome/input/hg38.chrom.sizes",
+  "Multiome.run_cellbender":"false",
+  "Multiome.Atac.cpu_platform_bwa":"Intel Cascade Lake",
+  "Multiome.Atac.num_threads_bwa":"16",
+  "Multiome.Atac.mem_size_bwa":"64", 
+  "Multiome.soloMultiMappers":"Uniform",
+  "Multiome.gex_nhash_id":"example_1234",
+  "Multiome.atac_nhash_id":"example_1234",
+  "Multiome.run_peak_calling":"true"
+}

From 0159899a6335b64d6b98ea79080d2da3f49e7e13 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 11:11:17 -0500
Subject: [PATCH 73/91] fix

---
 pipelines/skylab/multiome/Multiome.wdl | 3 ++-
 website/docs/Pipelines/ATAC/README.md  | 6 +++---
 2 files changed, 5 insertions(+), 4 deletions(-)

diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
index 46056dae5d..7822f754e5 100644
--- a/pipelines/skylab/multiome/Multiome.wdl
+++ b/pipelines/skylab/multiome/Multiome.wdl
@@ -152,8 +152,9 @@ workflow Multiome {
         File fragment_file_index = JoinBarcodes.atac_fragment_tsv_index
         File snap_metrics_atac = JoinBarcodes.atac_h5ad_file
         File atac_library_metrics = Atac.library_metrics_file
+        File? peak_call_atac = Atac.peakcall_h5ad_file
         File? cellbybin_h5ad_file = Atac.cellbybin_h5ad_file
-        File? cellbypeak_h5ad_file = Atac.cellbypeak_h5ad_file
+        File? cellbypeak_h5ad_file = Atac.cellbypeak_h5ad
 
         # optimus outputs
         File genomic_reference_version_gex = Optimus.genomic_reference_version
diff --git a/website/docs/Pipelines/ATAC/README.md b/website/docs/Pipelines/ATAC/README.md
index f3d7bc6767..aedaf51ed5 100644
--- a/website/docs/Pipelines/ATAC/README.md
+++ b/website/docs/Pipelines/ATAC/README.md
@@ -87,7 +87,7 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | [TrimAdapters](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | Cutadapt v4.4 | cutadapt | Trims adaptor sequences. |
 | [BWAPairedEndAlignment](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | bwa-mem2 | mem | Aligns reads from each set of partitioned FASTQ files to the genome and outputs a BAM with ATAC barcodes in the CB:Z tag. |
 | [CreateFragmentFile](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | make_fragment_file, import_data | SnapATAC2 | Generates a fragment file from the final aligned BAM and outputs per barcode quality metrics in h5ad. A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
-| [PeakCalling](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | macs3 | SnapATAC2 | Generates two h5ad files (`cellbybin.h5ad` and `cellbypeak.h5ad`) from the CreateFragmentFile h5ad output file (`metrics.h5ad`). The `peaks.h5ad` contains the peak called per cluster in the macs3 unstructured metadata and `matrix.h5ad` contains the merged peaks and the count matrix of peaks per fragment. A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
+| [PeakCalling](https://github.com/broadinstitute/warp/blob/master/pipelines/skylab/atac/atac.wdl) | macs3 | SnapATAC2 | Generates two h5ad files (`cellbybin.h5ad` and `cellbypeak.h5ad`) from the CreateFragmentFile h5ad output file (`metrics.h5ad`). The `cellbybin.h5ad` contains the peak called per cluster in the macs3 unstructured metadata and `cellbypeak.h5ad` contains the merged peaks and the count matrix of peaks per fragment. A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
 
 ## Output variables
 
@@ -97,8 +97,8 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | fragment_file | `<input_id>`.fragments.sorted.tsv.gz | Bgzipped TSV containing fragment start and stop coordinates per barcode. In order, the columns are "Chromosome", "Start", "Stop", "ATAC Barcode", and "Number Reads". | 
 | snap_metrics | `<input_id`.metrics.h5ad | h5ad (Anndata) containing per barcode metrics from [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
  library_metrics | `<input_id>`_`<atac_nhash_id>_library_metrics.csv | CSV file containing library-level metrics. Read more in the [Library Metrics Overview](library-metrics.md) |
-| snap_peaks | `<input_id`.cellbybin.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
-| snap_matrix | `<input_id`.cellbypeak.h5ad | h5ad (Anndata) containing per merged peaks (called by MACS3) per cluster and count matrix of peaks per fragment [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). 
+| snap_cellbybin | `<input_id`.cellbybin.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
+| snap_cellbypeak | `<input_id`.cellbypeak.h5ad | h5ad (Anndata) containing per merged peaks (called by MACS3) per cluster and count matrix of peaks per fragment [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). 
 
 ## Versioning and testing
 

From 6d95b962c00176e8bf196c83a1cc847015361864 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 11:14:57 -0500
Subject: [PATCH 74/91] fix

---
 pipelines/skylab/atac/atac.changelog.md            | 8 +++++---
 pipelines/skylab/atac/atac.wdl                     | 2 +-
 pipelines/skylab/multiome/Multiome.changelog.md    | 8 +++++---
 pipelines/skylab/multiome/Multiome.wdl             | 2 +-
 pipelines/skylab/paired_tag/PairedTag.changelog.md | 8 +++++---
 pipelines/skylab/paired_tag/PairedTag.wdl          | 2 +-
 6 files changed, 18 insertions(+), 12 deletions(-)

diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md
index 8145cb8761..636f57ac71 100644
--- a/pipelines/skylab/atac/atac.changelog.md
+++ b/pipelines/skylab/atac/atac.changelog.md
@@ -1,6 +1,8 @@
-# 2.6.1
-2025-01-31 (Date of Last Commit)
-* Added an optional PeakCalling task. Added a boolean variable run_peak_calling; default is false. 
+# 2.7.0
+2025-02-03 (Date of Last Commit)
+
+* Added an optional PeakCalling task 
+* Added a boolean variable peak_calling; default is false 
 
 # 2.6.0
 2025-01-21 (Date of Last Commit)
diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 2001fc875b..d9931517cb 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -51,7 +51,7 @@ workflow ATAC {
     String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"
   }
 
-  String pipeline_version = "2.6.1"
+  String pipeline_version = "2.7.0"
 
   # Determine docker prefix based on cloud provider
   String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/"
diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md
index e870007734..2dd910c46a 100644
--- a/pipelines/skylab/multiome/Multiome.changelog.md
+++ b/pipelines/skylab/multiome/Multiome.changelog.md
@@ -1,6 +1,8 @@
-# 5.9.7
-2025-01-31 (Date of Last Commit)
-* Added an optional PeakCalling task to the ATAC workflow. Added a boolean variable run_peak_calling to the Multiome pipeline; default is false. 
+# 5.10.0
+2025-02-03 (Date of Last Commit)
+
+* Added an optional PeakCalling task to the ATAC workflow 
+* Added a boolean variable run_peak_calling to the Multiome pipeline; default is false 
 
 # 5.9.6
 2025-01-21 (Date of Last Commit)
diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
index 7822f754e5..4309a1476c 100644
--- a/pipelines/skylab/multiome/Multiome.wdl
+++ b/pipelines/skylab/multiome/Multiome.wdl
@@ -7,7 +7,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow Multiome {
 
-    String pipeline_version = "5.9.7"
+    String pipeline_version = "5.10.0"
 
     input {
         String cloud_provider
diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md
index 3c303dd3e9..a1bf71667b 100644
--- a/pipelines/skylab/paired_tag/PairedTag.changelog.md
+++ b/pipelines/skylab/paired_tag/PairedTag.changelog.md
@@ -1,6 +1,8 @@
-# 1.10.1
-2025-01-31 (Date of Last Commit)
-* Added an optional PeakCalling task to the ATAC workflow. Added a boolean variable run_peak_calling to the Multiome pipeline; default is false. This does not affect the outputs of the pipeline
+# 1.11.0
+2025-02-03 (Date of Last Commit)
+
+* Added an optional PeakCalling task to the ATAC workflow; this does not affect the outputs of the pipeline
+* Added a boolean variable run_peak_calling to the Multiome pipeline; default is false and this does not affect the outputs of the pipeline
 
 # 1.10.0
 2025-01-21 (Date of Last Commit)
diff --git a/pipelines/skylab/paired_tag/PairedTag.wdl b/pipelines/skylab/paired_tag/PairedTag.wdl
index 05d1b74b96..99a67dc365 100644
--- a/pipelines/skylab/paired_tag/PairedTag.wdl
+++ b/pipelines/skylab/paired_tag/PairedTag.wdl
@@ -8,7 +8,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow PairedTag {
 
-    String pipeline_version = "1.10.1"
+    String pipeline_version = "1.11.0"
 
 
     input {

From c2e4649a1ab377cbbb7b2003f8a2f10eb1ae3851 Mon Sep 17 00:00:00 2001
From: GitHub Action <action@github.com>
Date: Mon, 3 Feb 2025 16:15:23 +0000
Subject: [PATCH 75/91] Updated pipeline_versions.txt with all pipeline version
 information

---
 pipeline_versions.txt | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/pipeline_versions.txt b/pipeline_versions.txt
index f2cfe20fed..74b548c199 100644
--- a/pipeline_versions.txt
+++ b/pipeline_versions.txt
@@ -27,14 +27,14 @@ MultiSampleArrays	 1.6.2	2024-08-02
 ValidateChip	 1.16.7	2024-11-04 
 Arrays	 2.6.30	2024-11-04 
 AnnotationFiltration	 1.2.7	2024-11-04 
-Multiome	 5.9.7	2025-01-31 
+Multiome	 5.10.0	2025-02-03 
 snm3C	 4.0.4	2024-08-06 
 SlideSeq	 3.4.8	2025-01-13 
 scATAC	 1.3.2	2023-08-03 
 BuildIndices	 4.0.0	2025-01-17 
 MultiSampleSmartSeq2	 2.2.22	2024-09-11 
 Optimus	 7.9.1	2025-01-13 
-atac	 2.6.1	2025-01-31 
-PairedTag	 1.10.1	2025-01-31 
+atac	 2.7.0	2025-02-03 
+PairedTag	 1.11.0	2025-02-03 
 SmartSeq2SingleSample	 5.1.21	2024-09-11 
 MultiSampleSmartSeq2SingleNucleus	 2.0.7	2025-01-13 

From 9dd8e2adfa98dfa61ba5308d97de7b96cfcf7132 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 11:19:50 -0500
Subject: [PATCH 76/91] fix

---
 website/docs/Pipelines/ATAC/README.md | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/website/docs/Pipelines/ATAC/README.md b/website/docs/Pipelines/ATAC/README.md
index aedaf51ed5..6989fead44 100644
--- a/website/docs/Pipelines/ATAC/README.md
+++ b/website/docs/Pipelines/ATAC/README.md
@@ -97,8 +97,8 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | fragment_file | `<input_id>`.fragments.sorted.tsv.gz | Bgzipped TSV containing fragment start and stop coordinates per barcode. In order, the columns are "Chromosome", "Start", "Stop", "ATAC Barcode", and "Number Reads". | 
 | snap_metrics | `<input_id`.metrics.h5ad | h5ad (Anndata) containing per barcode metrics from [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
  library_metrics | `<input_id>`_`<atac_nhash_id>_library_metrics.csv | CSV file containing library-level metrics. Read more in the [Library Metrics Overview](library-metrics.md) |
-| snap_cellbybin | `<input_id`.cellbybin.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
-| snap_cellbypeak | `<input_id`.cellbypeak.h5ad | h5ad (Anndata) containing per merged peaks (called by MACS3) per cluster and count matrix of peaks per fragment [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). 
+| snap_cellbybin | `<input_id>`.cellbybin.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster [SnapATAC2](https://github.com/kaizhang/SnapATAC2). |
+| snap_cellbypeak | `<input_id>`.cellbypeak.h5ad | h5ad (Anndata) containing merged peaks (called by MACS3) per cluster and count matrix of insertion sites per peak and cell [SnapATAC2](https://github.com/kaizhang/SnapATAC2). 
 
 ## Versioning and testing
 

From 89189c0b34e3b344426e8e41c8708acb15ab5678 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 11:22:01 -0500
Subject: [PATCH 77/91] fix

---
 pipelines/skylab/paired_tag/PairedTag.changelog.md | 2 +-
 pipelines/skylab/paired_tag/PairedTag.wdl          | 2 +-
 website/docs/Pipelines/ATAC/README.md              | 2 +-
 3 files changed, 3 insertions(+), 3 deletions(-)

diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md
index a1bf71667b..403d6ce5b5 100644
--- a/pipelines/skylab/paired_tag/PairedTag.changelog.md
+++ b/pipelines/skylab/paired_tag/PairedTag.changelog.md
@@ -1,4 +1,4 @@
-# 1.11.0
+# 1.10.1
 2025-02-03 (Date of Last Commit)
 
 * Added an optional PeakCalling task to the ATAC workflow; this does not affect the outputs of the pipeline
diff --git a/pipelines/skylab/paired_tag/PairedTag.wdl b/pipelines/skylab/paired_tag/PairedTag.wdl
index 99a67dc365..05d1b74b96 100644
--- a/pipelines/skylab/paired_tag/PairedTag.wdl
+++ b/pipelines/skylab/paired_tag/PairedTag.wdl
@@ -8,7 +8,7 @@ import "../../../tasks/broad/Utilities.wdl" as utils
 
 workflow PairedTag {
 
-    String pipeline_version = "1.11.0"
+    String pipeline_version = "1.10.1"
 
 
     input {
diff --git a/website/docs/Pipelines/ATAC/README.md b/website/docs/Pipelines/ATAC/README.md
index 6989fead44..cd19ec4ac1 100644
--- a/website/docs/Pipelines/ATAC/README.md
+++ b/website/docs/Pipelines/ATAC/README.md
@@ -98,7 +98,7 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | snap_metrics | `<input_id`.metrics.h5ad | h5ad (Anndata) containing per barcode metrics from [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
  library_metrics | `<input_id>`_`<atac_nhash_id>_library_metrics.csv | CSV file containing library-level metrics. Read more in the [Library Metrics Overview](library-metrics.md) |
 | snap_cellbybin | `<input_id>`.cellbybin.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster [SnapATAC2](https://github.com/kaizhang/SnapATAC2). |
-| snap_cellbypeak | `<input_id>`.cellbypeak.h5ad | h5ad (Anndata) containing merged peaks (called by MACS3) per cluster and count matrix of insertion sites per peak and cell [SnapATAC2](https://github.com/kaizhang/SnapATAC2). 
+| snap_cellbypeak | `<input_id>`.cellbypeak.h5ad | h5ad (Anndata) containing merged peaks (called by MACS3) per cluster and count matrix of insertion sites per peak and cell [SnapATAC2](https://github.com/kaizhang/SnapATAC2).|
 
 ## Versioning and testing
 

From 86bee87f6ca63291f26da5341e25a7a2a72fc14f Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 11:22:52 -0500
Subject: [PATCH 78/91] fix

---
 website/docs/Pipelines/ATAC/README.md | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/website/docs/Pipelines/ATAC/README.md b/website/docs/Pipelines/ATAC/README.md
index cd19ec4ac1..7cfde275da 100644
--- a/website/docs/Pipelines/ATAC/README.md
+++ b/website/docs/Pipelines/ATAC/README.md
@@ -97,8 +97,8 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | fragment_file | `<input_id>`.fragments.sorted.tsv.gz | Bgzipped TSV containing fragment start and stop coordinates per barcode. In order, the columns are "Chromosome", "Start", "Stop", "ATAC Barcode", and "Number Reads". | 
 | snap_metrics | `<input_id`.metrics.h5ad | h5ad (Anndata) containing per barcode metrics from [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
  library_metrics | `<input_id>`_`<atac_nhash_id>_library_metrics.csv | CSV file containing library-level metrics. Read more in the [Library Metrics Overview](library-metrics.md) |
-| snap_cellbybin | `<input_id>`.cellbybin.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster [SnapATAC2](https://github.com/kaizhang/SnapATAC2). |
-| snap_cellbypeak | `<input_id>`.cellbypeak.h5ad | h5ad (Anndata) containing merged peaks (called by MACS3) per cluster and count matrix of insertion sites per peak and cell [SnapATAC2](https://github.com/kaizhang/SnapATAC2).|
+| snap_cellbybin | `<input_id>`.cellbybin.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster. [SnapATAC2](https://github.com/kaizhang/SnapATAC2). |
+| snap_cellbypeak | `<input_id>`.cellbypeak.h5ad | h5ad (Anndata) containing merged peaks (called by MACS3) per cluster and count matrix of insertion sites per peak and cell. [SnapATAC2](https://github.com/kaizhang/SnapATAC2).|
 
 ## Versioning and testing
 

From d2a77e712f9f4819d94b6d6c18505ee9457e190b Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 11:24:08 -0500
Subject: [PATCH 79/91] fix

---
 website/docs/Pipelines/ATAC/README.md | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/website/docs/Pipelines/ATAC/README.md b/website/docs/Pipelines/ATAC/README.md
index 7cfde275da..0d5ee42458 100644
--- a/website/docs/Pipelines/ATAC/README.md
+++ b/website/docs/Pipelines/ATAC/README.md
@@ -96,7 +96,7 @@ To see specific tool parameters, select the task WDL link in the table; then vie
 | bam_aligned_output | `<input_id>`.bam | BAM containing aligned reads from ATAC workflow. |
 | fragment_file | `<input_id>`.fragments.sorted.tsv.gz | Bgzipped TSV containing fragment start and stop coordinates per barcode. In order, the columns are "Chromosome", "Start", "Stop", "ATAC Barcode", and "Number Reads". | 
 | snap_metrics | `<input_id`.metrics.h5ad | h5ad (Anndata) containing per barcode metrics from [SnapATAC2](https://github.com/kaizhang/SnapATAC2). A detailed list of these metrics is found in the [ATAC Count Matrix Overview](./count-matrix-overview.md). |
- library_metrics | `<input_id>`_`<atac_nhash_id>_library_metrics.csv | CSV file containing library-level metrics. Read more in the [Library Metrics Overview](library-metrics.md) |
+ library_metrics | `<input_id>`_`<atac_nhash_id>`_library_metrics.csv | CSV file containing library-level metrics. Read more in the [Library Metrics Overview](library-metrics.md) |
 | snap_cellbybin | `<input_id>`.cellbybin.h5ad | h5ad (Anndata) containing peaks (called by MACS3) per cluster. [SnapATAC2](https://github.com/kaizhang/SnapATAC2). |
 | snap_cellbypeak | `<input_id>`.cellbypeak.h5ad | h5ad (Anndata) containing merged peaks (called by MACS3) per cluster and count matrix of insertion sites per peak and cell. [SnapATAC2](https://github.com/kaizhang/SnapATAC2).|
 

From 15950eca4a8769b9067b391ffeaf363305b1fb82 Mon Sep 17 00:00:00 2001
From: GitHub Action <action@github.com>
Date: Mon, 3 Feb 2025 16:26:23 +0000
Subject: [PATCH 80/91] Updated pipeline_versions.txt with all pipeline version
 information

---
 pipeline_versions.txt | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipeline_versions.txt b/pipeline_versions.txt
index 74b548c199..0aafa27cf9 100644
--- a/pipeline_versions.txt
+++ b/pipeline_versions.txt
@@ -35,6 +35,6 @@ BuildIndices	 4.0.0	2025-01-17
 MultiSampleSmartSeq2	 2.2.22	2024-09-11 
 Optimus	 7.9.1	2025-01-13 
 atac	 2.7.0	2025-02-03 
-PairedTag	 1.11.0	2025-02-03 
+PairedTag	 1.10.1	2025-02-03 
 SmartSeq2SingleSample	 5.1.21	2024-09-11 
 MultiSampleSmartSeq2SingleNucleus	 2.0.7	2025-01-13 

From 049af9d93e5bbf11e26933fae751921dbf527b04 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 11:39:22 -0500
Subject: [PATCH 81/91] fix

---
 pipelines/skylab/multiome/Multiome.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
index 4309a1476c..3b73b9b31a 100644
--- a/pipelines/skylab/multiome/Multiome.wdl
+++ b/pipelines/skylab/multiome/Multiome.wdl
@@ -154,7 +154,7 @@ workflow Multiome {
         File atac_library_metrics = Atac.library_metrics_file
         File? peak_call_atac = Atac.peakcall_h5ad_file
         File? cellbybin_h5ad_file = Atac.cellbybin_h5ad_file
-        File? cellbypeak_h5ad_file = Atac.cellbypeak_h5ad
+        File? cellbypeak_h5ad_file = Atac.cellbypeak_h5ad_file
 
         # optimus outputs
         File genomic_reference_version_gex = Optimus.genomic_reference_version

From 1a02ba72c6143568546405e9ec34a4f44b6ae94a Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Mon, 3 Feb 2025 12:03:00 -0500
Subject: [PATCH 82/91] fix

---
 pipelines/skylab/multiome/Multiome.wdl | 1 -
 1 file changed, 1 deletion(-)

diff --git a/pipelines/skylab/multiome/Multiome.wdl b/pipelines/skylab/multiome/Multiome.wdl
index 3b73b9b31a..d079e5c58a 100644
--- a/pipelines/skylab/multiome/Multiome.wdl
+++ b/pipelines/skylab/multiome/Multiome.wdl
@@ -152,7 +152,6 @@ workflow Multiome {
         File fragment_file_index = JoinBarcodes.atac_fragment_tsv_index
         File snap_metrics_atac = JoinBarcodes.atac_h5ad_file
         File atac_library_metrics = Atac.library_metrics_file
-        File? peak_call_atac = Atac.peakcall_h5ad_file
         File? cellbybin_h5ad_file = Atac.cellbybin_h5ad_file
         File? cellbypeak_h5ad_file = Atac.cellbypeak_h5ad_file
 

From ba0982a433a46ec307e7cb734cecea9480539764 Mon Sep 17 00:00:00 2001
From: ekiernan <ekiernan@broadinstitute.org>
Date: Mon, 3 Feb 2025 14:08:41 -0500
Subject: [PATCH 83/91] updating TestMultiome to run peak calling

---
 verification/test-wdls/TestMultiome.wdl | 4 +++-
 1 file changed, 3 insertions(+), 1 deletion(-)

diff --git a/verification/test-wdls/TestMultiome.wdl b/verification/test-wdls/TestMultiome.wdl
index d2fcd0eb9a..e710bb1942 100644
--- a/verification/test-wdls/TestMultiome.wdl
+++ b/verification/test-wdls/TestMultiome.wdl
@@ -52,6 +52,7 @@ workflow TestMultiome {
       String vault_token_path
       String google_account_vault_path
       Boolean run_cellbender = false
+      Boolean run_peak_calling = false
 
     }
 
@@ -86,7 +87,8 @@ workflow TestMultiome {
         soloMultiMappers = soloMultiMappers,
         cloud_provider = cloud_provider,
         gex_nhash_id = gex_nhash_id,
-        atac_nhash_id = atac_nhash_id
+        atac_nhash_id = atac_nhash_id,
+        run_peak_calling = run_peak_calling
     }
 
     

From 1023faa2cf0cafd1ca8cea3c9026cf6f7f7203da Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Mon, 3 Feb 2025 14:42:15 -0500
Subject: [PATCH 84/91] update expected_cells and parameterize probability
 thresholds

---
 pipelines/skylab/atac/atac.wdl | 4 +++-
 1 file changed, 3 insertions(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index d9931517cb..11ab27103e 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -559,7 +559,7 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
-    expected_cells = ~{atac_expected_cells}
+    expected_cells = "~{atac_expected_cells}"
 
     # calculate chrom size dictionary based on text file
     chrom_size_dict={}
@@ -668,6 +668,7 @@ task PeakCalling {
     Int min_counts = 5000
     Int min_tsse = 10
     Int max_counts = 100000
+    Float probability_threshold = 0.5
     # Runtime attributes/docker
     String docker_path
     Int disk_size = 500
@@ -702,6 +703,7 @@ task PeakCalling {
     min_counts = "~{min_counts}"
     min_tsse = "~{min_tsse}"
     max_counts = "~{max_counts}"
+    probability_threshold = "~{probability_threshold}"
 
     print("Peak calling starting...")
     atac_data = snap.read(metrics_h5ad)

From 09adf51c0944ee38ab13928b096b2818b6530a11 Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Mon, 3 Feb 2025 14:47:49 -0500
Subject: [PATCH 85/91] expected cells as integer

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 11ab27103e..24b3f103e0 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -559,7 +559,7 @@ task CreateFragmentFile {
     atac_gtf = "~{annotations_gtf}"
     preindex = "~{preindex}"
     atac_nhash_id = "~{atac_nhash_id}"
-    expected_cells = "~{atac_expected_cells}"
+    expected_cells = ~{atac_expected_cells}
 
     # calculate chrom size dictionary based on text file
     chrom_size_dict={}

From 2681b75c29c46de271e3836b8e8d20c78245686b Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 4 Feb 2025 09:24:04 -0500
Subject: [PATCH 86/91] fix

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 24b3f103e0..f39c8a77c8 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -746,7 +746,7 @@ task PeakCalling {
         
     # Filter doublets based on scrublet scores 
     print("Filter doublets based on scrublet scores")
-    snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.5)
+    snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.01)
     print(atac_data_mod)
         
     # Perform graph-based clustering to identify cell clusters. 

From 6a5f83f7c88cc82e6637dd8d657fb620f6e54b79 Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Tue, 4 Feb 2025 11:26:03 -0500
Subject: [PATCH 87/91] update probability_threshold

---
 pipelines/skylab/atac/atac.wdl | 5 +++--
 1 file changed, 3 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index f39c8a77c8..0f9826dde8 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -668,7 +668,8 @@ task PeakCalling {
     Int min_counts = 5000
     Int min_tsse = 10
     Int max_counts = 100000
-    Float probability_threshold = 0.5
+    Float probability_threshold = 0.01
+
     # Runtime attributes/docker
     String docker_path
     Int disk_size = 500
@@ -746,7 +747,7 @@ task PeakCalling {
         
     # Filter doublets based on scrublet scores 
     print("Filter doublets based on scrublet scores")
-    snap.pp.filter_doublets(atac_data_mod, probability_threshold=0.01)
+    snap.pp.filter_doublets(atac_data_mod, probability_threshold=probability_threshold)
     print(atac_data_mod)
         
     # Perform graph-based clustering to identify cell clusters. 

From e1cdc1453c24776e3c5d92add2122b5856dce3e2 Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Tue, 4 Feb 2025 13:14:19 -0500
Subject: [PATCH 88/91] remove quotes around probability_threshold

---
 pipelines/skylab/atac/atac.wdl | 4 ++--
 1 file changed, 2 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 0f9826dde8..bb41cb0688 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -675,7 +675,7 @@ task PeakCalling {
     Int disk_size = 500
     Int mem_size = 64
     Int nthreads = 4   
-  }
+  }gi
   
   parameter_meta {
     annotations_gtf: "GTF for SnapATAC2 to calculate TSS sites of fragment file."
@@ -704,7 +704,7 @@ task PeakCalling {
     min_counts = "~{min_counts}"
     min_tsse = "~{min_tsse}"
     max_counts = "~{max_counts}"
-    probability_threshold = "~{probability_threshold}"
+    probability_threshold = ~{probability_threshold}
 
     print("Peak calling starting...")
     atac_data = snap.read(metrics_h5ad)

From 92468efb74c7fce832f16da7c01940c1faf6f743 Mon Sep 17 00:00:00 2001
From: Sid Cox <sidcox@broadinstitute.org>
Date: Tue, 4 Feb 2025 13:37:57 -0500
Subject: [PATCH 89/91] remove typo

---
 pipelines/skylab/atac/atac.wdl | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index bb41cb0688..72c6687a7c 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -675,7 +675,7 @@ task PeakCalling {
     Int disk_size = 500
     Int mem_size = 64
     Int nthreads = 4   
-  }gi
+  }
   
   parameter_meta {
     annotations_gtf: "GTF for SnapATAC2 to calculate TSS sites of fragment file."

From 6bca8f53f45c5c3a89a734b18db8596774f15ecb Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 4 Feb 2025 14:14:59 -0500
Subject: [PATCH 90/91] fix

---
 pipelines/skylab/atac/atac.wdl | 8 ++++++--
 1 file changed, 6 insertions(+), 2 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 72c6687a7c..890d9001eb 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -704,11 +704,15 @@ task PeakCalling {
     min_counts = "~{min_counts}"
     min_tsse = "~{min_tsse}"
     max_counts = "~{max_counts}"
-    probability_threshold = ~{probability_threshold}
+    probability_threshold = "~{probability_threshold}"
+
+    print(type(probability_threshold)) 
+    probability_threshold = float(probability_threshold)
+    print(type(probability_threshold)) 
 
     print("Peak calling starting...")
     atac_data = snap.read(metrics_h5ad)
-
+    
     # Calculate and plot the size distribution of fragments
     print("Calculating fragment size distribution")
     snap.pl.frag_size_distr(atac_data)

From 01249c26e59c56ddbc6dca8e1486555085de1774 Mon Sep 17 00:00:00 2001
From: aawdeh <awdeh@broadinstitute.org>
Date: Tue, 4 Feb 2025 14:44:30 -0500
Subject: [PATCH 91/91] fix

---
 pipelines/skylab/atac/atac.wdl | 4 +---
 1 file changed, 1 insertion(+), 3 deletions(-)

diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl
index 890d9001eb..3c74822c93 100644
--- a/pipelines/skylab/atac/atac.wdl
+++ b/pipelines/skylab/atac/atac.wdl
@@ -668,7 +668,7 @@ task PeakCalling {
     Int min_counts = 5000
     Int min_tsse = 10
     Int max_counts = 100000
-    Float probability_threshold = 0.01
+    Float probability_threshold = 1
 
     # Runtime attributes/docker
     String docker_path
@@ -706,9 +706,7 @@ task PeakCalling {
     max_counts = "~{max_counts}"
     probability_threshold = "~{probability_threshold}"
 
-    print(type(probability_threshold)) 
     probability_threshold = float(probability_threshold)
-    print(type(probability_threshold)) 
 
     print("Peak calling starting...")
     atac_data = snap.read(metrics_h5ad)