diff --git a/.gitignore b/.gitignore
new file mode 100644
index 0000000..173b448
--- /dev/null
+++ b/.gitignore
@@ -0,0 +1,2 @@
+token*
+node_modules
\ No newline at end of file
diff --git a/README.md b/README.md
index 8d11a34..907c51e 100644
--- a/README.md
+++ b/README.md
@@ -10,16 +10,35 @@
 4. Drag your token files into the codespace root directory, they should be named token
 6. Run the following commands in the terminal
 ```bash
-run.sh
+sh run.sh
 ```
+6.1 to check if everything is ok, run the following command
+```bash
+docker ps -a
+docker logs [insert CONTAINER ID from previous command]
+```
+
 7. Open a new terminal window and run the following command to test the synthclient
 ```bash
-curl -X POST -H "Content-Type: application/json" -d @test.json https://api.securedna.org/synth/v1/synth
+sh simple_test.sh
 ```
-8. Try a more complex example by running the following command
+8. Try a more complex example by running the following command. This example shows how to use the synthclient to process a fasta file and calculate some statistics
 ```bash
 npx ts-node test.ts
 ```
+
+The output should look like this:
+```
+=== Processing file:  test.fasta
+[
+  {
+    organism: 'Ricin',
+    percentageHit: 11.182795698924732,
+    longestHitregion: 96,
+    longestUniqueHitRegion: 96
+  }
+]
+```
 9. Enjoy!
 
 
diff --git a/adv_test.ts b/adv_test.ts
new file mode 100644
index 0000000..86ed6e2
--- /dev/null
+++ b/adv_test.ts
@@ -0,0 +1,339 @@
+const fs = require('node:fs/promises');
+const path = require ('node:path');
+
+
+let influenzaLargestCounter = 0;
+let influenzaCounted = [];
+
+/** A request to the /v1/screen endpoint. */
+interface ApiRequest {
+  /**
+  * The input FASTA. This field MUST be included.
+  */
+  fasta: string,
+  /**
+  * The screening region. This field MUST be included.
+  * See below for more details.
+  */
+  region: "us" | "prc" | "eu" | "all";
+  /**
+  * An optional arbitrary string that will be returned in the
+  * response, for your tracking purposes. This field MAY be included.
+  *
+  * Note that this string may be logged in our backend, so be careful
+  * about including sensitive information (such as customer names).
+  */
+  provider_reference?: string | null,
+}
+
+
+/** The top-level response. */
+export interface ApiResponse {
+  /** Whether synthesis should be allowed to proceed. */
+  synthesis_permission: "granted" | "denied";
+  /** If provided in the input, `provider_reference` will be
+  * returned here. `null` otherwise.
+  */
+
+  provider_reference?: string | null;
+  /**
+  * If `synthesis_permission` is `"denied"` due to one or more
+  * screening hits, this list will contain those hits, grouped
+  * by which record they occurred in.
+  */
+  hits_by_record?: FastaRecordHits[];
+  /** Any non-fatal warnings will be in this list. */
+  warnings?: ErrorOrWarning[];
+  /**
+  * Will contain fatal errors if `synthesis_permission
+  * is `"denied"` due to an error.
+  */
+  errors?: ErrorOrWarning[];
+}
+
+/** Screening hits, grouped by which record they occurred in. */
+export interface FastaRecordHits {
+  /** The record header, possibly empty. */
+  fasta_header: string;
+  /** Line range in FASTA input this record covers. */
+  line_number_range: [number, number];
+  /** The length of the record sequence. */
+  sequence_length: number;
+  /**
+  * The hits that occurred in this record, grouped by similarity.
+  */
+  hits_by_hazard: HazardHits[];
+}
+
+/** A list of hits grouped by similarity. */
+export interface HazardHits {
+  /** Whether this hit group matched nucleotides or amino acids. */
+  type: "nuc" | "aa";
+  /**
+  * Whether this hit group matched a hazard wild type
+  * (observed genome) or predicted functional variant
+  * (mutation SecureDNA believes would still be hazardous).
+  * This field is always `null` for `type: "nuc"` hit groups.
+  */
+  is_wild_type: boolean | null;
+  /**
+  * A list of regions in the sequence that matched this
+  * hazard group.
+  */
+
+
+  hit_regions: HitRegion[];
+  /** The most likely organism match for this hazard group. */
+  most_likely_organism: Organism;
+  /**
+  * All possible hazard matches for this hazard group,
+  * including `most_likely_organism`.
+  */
+  organisms: Organism[];
+}
+/** A region of a record sequence that matched one or more hazards. */
+export interface HitRegion {
+  /** The matching subsequence. */
+  seq: string;
+  /** The start of `seq` in the record sequence, in bp. */
+  seq_range_start: number;
+  /** The (exclusive) end of `seq` in the record sequence, in bp. */
+  seq_range_end: number;
+}
+/** Organism metadata. */
+export interface Organism {
+  /** The SecureDNA name for this organism. */
+  name: string;
+  /** The high-level classification of this organism. */
+  organism_type: "Virus" | "Toxin" | "Bacterium" | "Fungus";
+  /** A list of NCBI accession numbers for this organism. */
+  ans: string[];
+  /**
+  * A list of SecureDNA tags for this organism.
+  * A table of current tags is included below,
+  * but more may be added in the future.
+  */
+  tags: string[];
+}
+/** An error or warning. */
+export type ErrorOrWarning = {
+  /**
+  * The diagnostic code.
+  * A list of current diagnostic codes is provided
+  * below, but more may be added in the future.
+  */
+  diagnostic: string;
+  /** Additional information about the cause of this error. */
+  additional_info: string;
+  /**
+  * If applicable, a line number range in the
+  * * input FASTA that caused this error or warning.
+  */
+  line_number_range?: [number, number] | null;
+}
+
+async function screen(name, fasta) {
+
+  let response;
+
+  const request: ApiRequest = {
+    fasta: fasta,
+    region: 'all',
+    provider_reference: 'test'
+  };
+  response = await fetch('http://localhost:80/v1/screen', {
+    method: 'POST',
+    headers: {
+      'Content-Type': 'application/json',
+    },
+    body: JSON.stringify(request),
+  }).then(res => res.json());
+
+  const json = response as ApiResponse;
+
+  const hitsByOrganism: { [organism: string]: HitRegion[] } = {};
+
+  if (json.hits_by_record) {
+    json.hits_by_record.forEach(record => {
+      record.hits_by_hazard.forEach(hazard => {
+        const organismName = hazard.most_likely_organism.name;
+        if (!hitsByOrganism[organismName]) {
+          hitsByOrganism[organismName] = [];
+        }
+        hitsByOrganism[organismName].push(...hazard.hit_regions);
+      });
+    });
+  }
+
+  // =================
+  // join hit regions
+  // =================
+  const joinedHitsByOrganism: { [organism: string]: HitRegion[] } = {};
+
+  for(const organism in hitsByOrganism) {
+    const sortedHitRegions = hitsByOrganism[organism].flat().sort((a, b) => a.seq_range_start - b.seq_range_start);
+
+    // Join overlapping hit regions
+    const mergedHitRegions: HitRegion[] = [];
+    let currentHitRegion: HitRegion | undefined = undefined;
+
+    for (const hitRegion of sortedHitRegions) {
+      if (!currentHitRegion) {
+        currentHitRegion = hitRegion;
+      } else if (hitRegion.seq_range_start <= currentHitRegion.seq_range_end) {
+        currentHitRegion.seq_range_end = Math.max(currentHitRegion.seq_range_end, hitRegion.seq_range_end);
+      } else {
+        mergedHitRegions.push(currentHitRegion);
+        currentHitRegion = hitRegion;
+      }
+    }
+
+    if (currentHitRegion) {
+      mergedHitRegions.push(currentHitRegion);
+    }
+
+    joinedHitsByOrganism[organism] = mergedHitRegions;
+
+  }
+
+  // Calculate the length of FASTA sequence
+  const fastaWithoutFirstLine = fasta.substring(fasta.indexOf('\n') + 1);
+  const fastaWithoutWhitespace = fastaWithoutFirstLine.replace(/\s/g, '');
+  const totalSequenceLength = fastaWithoutWhitespace.length;
+  
+  // =================
+  // Find unique indices per organism
+  // =================
+
+  const uniqueIndicesByOrganism: { [organism: string]: number[] } = {};
+
+  for (let i = 0; i < totalSequenceLength; i++) {
+    let uniqueOrganism: string | undefined = undefined;
+
+    for (const organism in joinedHitsByOrganism) {
+      const hitRegions = joinedHitsByOrganism[organism];
+      let isUnique = true;
+
+      for (const hitRegion of hitRegions) {
+        if (i >= hitRegion.seq_range_start && i < hitRegion.seq_range_end) {
+          if (uniqueOrganism && uniqueOrganism !== organism) {
+            isUnique = false;
+            break;
+          }
+          uniqueOrganism = organism;
+        }
+      }
+
+      if (!isUnique) {
+        break;
+      }
+    }
+
+    if (uniqueOrganism) {
+      if (!uniqueIndicesByOrganism[uniqueOrganism]) {
+        uniqueIndicesByOrganism[uniqueOrganism] = [];
+      }
+      uniqueIndicesByOrganism[uniqueOrganism].push(i);
+    }
+  }
+
+  // =================
+  // join unique overlapping indices into segments
+  // =================
+  
+  const joinedUniqueIndicesByOrganism: { [organism: string]: { start: number, end: number }[] } = {};
+
+  for (const organism in uniqueIndicesByOrganism) {
+    const indices = uniqueIndicesByOrganism[organism];
+    const joinedIndices: { start: number, end: number }[] = [];
+
+    let currentStart = indices[0];
+    let currentEnd = indices[0];
+
+    for (let i = 1; i < indices.length; i++) {
+      if (indices[i] === currentEnd + 1) {
+        currentEnd = indices[i];
+      } else {
+        joinedIndices.push({ start: currentStart, end: currentEnd + 1 });
+        currentStart = indices[i];
+        currentEnd = indices[i];
+      }
+    }
+
+    joinedIndices.push({ start: currentStart, end: currentEnd + 1 });
+
+    joinedUniqueIndicesByOrganism[organism] = joinedIndices;
+  }
+  
+
+
+  // =================
+  // Calculate the percentage of the sequence that is a hit
+  // =================
+  const sortedOrganisms: { organism: string; percentageHit: number, longestHitregion: number, longestUniqueHitRegion: number }[] = [];
+  for (const organism in joinedHitsByOrganism) {
+      let longestHitregion = 0;
+      const hitRegions = joinedHitsByOrganism[organism];
+      let totalHitLength = 0;
+  
+      for (const hitRegion of hitRegions) {
+          const hitLength = hitRegion.seq_range_end - hitRegion.seq_range_start;
+          if(hitLength > longestHitregion) {
+            longestHitregion = hitLength;
+          }
+          totalHitLength += hitLength;
+      }
+  
+      const percentageHit = (totalHitLength / totalSequenceLength) * 100;
+  
+      sortedOrganisms.push({ organism, percentageHit, longestHitregion, longestUniqueHitRegion: 0 });
+  }
+  
+  sortedOrganisms.sort((a, b) => b.longestHitregion - a.longestHitregion);
+
+
+  // =================
+  // Calculate the longest unique subsequence sequence that is unique
+  // =================
+  for (const organism in joinedUniqueIndicesByOrganism) {
+    const uniqueIndices = joinedUniqueIndicesByOrganism[organism];
+    let longestUniqueHitRegion = 0;
+
+    for (const indices of uniqueIndices) {
+      const uniqueHitLength = indices.end - indices.start;
+      if (uniqueHitLength > longestUniqueHitRegion) {
+        longestUniqueHitRegion = uniqueHitLength;
+      }
+    }
+
+    sortedOrganisms.find(item => item.organism === organism).longestUniqueHitRegion = longestUniqueHitRegion;
+  }
+
+  console.log(sortedOrganisms);
+
+}
+
+
+async function processFastaFiles() {
+  try {
+    const fastaDirectory = './fasta';
+    const files = await fs.readdir(fastaDirectory);
+
+    let i = 0;
+    for (const file of files) {
+      if(file.startsWith('.')) {
+        continue
+      }
+      const filePath = path.join(fastaDirectory, file);
+      const content = await fs.readFile(filePath, 'utf8');
+
+      console.log("=== Processing file: ", file);
+      await screen(file, content)
+    }
+  } catch (error) {
+    console.error('Error processing FASTA files:', error);
+  }
+
+}
+
+processFastaFiles();
diff --git a/fasta/test.fasta b/fasta/test.fasta
new file mode 100644
index 0000000..413e5ab
--- /dev/null
+++ b/fasta/test.fasta
@@ -0,0 +1,25 @@
+>Test 1
+atggaatttgggctgcgctgggttttccttgttgctattttaaaagatgtccagtgtgac
+gtgcaactggtggagtccgggggaggcttagttcagcctggggggtccctgagactctcc
+tgcgcagcctctggattcgcctacagtagtttttggatgcactgggtccgccaagctcca
+gggaggggtctggtgtgggtctcacgtattaatcctgatgggagaatcacagtctacgcg
+gacgccgtaaagggccgattcaccatctccagagacaacgccaagaacacgctctatctc
+caaatgaacaacctgagagccgaggacacggctgtttattactgtgcaagagggacacga
+tttctggagttgacttctaggggacaaatggaccagtggggccagggaaccctggtcact
+gtctcctcagcctccaccaagggcccatcggtcttccccctggcaccctcctccaagagc
+acctctgggggcacagcggccgtctcaaagcccCGTgggaacactatagtcatctggttt
+tacgccgttgcgacctggttaTTCttcgggagtacgagtggctggagttttaccctcgaa
+gacaacaatGTCtttccgaagcagtatccgatcattaatttcacaactgcaggagcgATC
+gttcaatcatataccaacttcattcgggcggtaagaggacgccttGCCacaggtgcagac
+gtgcggcacgagatccccgttctcccgaatcggGCGggccttcccatcaatcagcgcttc
+atactggtggagttgagcaacTACgccgaactaagtgtcacgctcgcactcgacgttaca
+aatgcttacATGgttggttatcgagcaggtaactctgccttttgagacgaaCACCTGGGC
+TGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTG
+ACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGC
+AGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAAT
+CACAAGCCCAGCAACACCAAGGTGGACAAGAAAGTTGAGCCCAAATCTTGTGACAAAACT
+CACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTC
+CCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTG
+GTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAG
+GTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTC
+AGCGTCCTCACCGTC
diff --git a/package-lock.json b/package-lock.json
new file mode 100644
index 0000000..152aece
--- /dev/null
+++ b/package-lock.json
@@ -0,0 +1,34 @@
+{
+  "name": "securedna-synthclien-template",
+  "lockfileVersion": 3,
+  "requires": true,
+  "packages": {
+    "": {
+      "devDependencies": {
+        "@types/node": "^7.10.14",
+        "typescript": "^5.5.4"
+      }
+    },
+    "node_modules/@types/node": {
+      "version": "7.10.14",
+      "resolved": "https://registry.npmjs.org/@types/node/-/node-7.10.14.tgz",
+      "integrity": "sha512-29GS75BE8asnTno3yB6ubOJOO0FboExEqNJy4bpz0GSmW/8wPTNL4h9h63c6s1uTrOopCmJYe/4yJLh5r92ZUA==",
+      "dev": true,
+      "license": "MIT"
+    },
+    "node_modules/typescript": {
+      "version": "5.6.3",
+      "resolved": "https://registry.npmjs.org/typescript/-/typescript-5.6.3.tgz",
+      "integrity": "sha512-hjcS1mhfuyi4WW8IWtjP7brDrG2cuDZukyrYrSauoXGNgx0S7zceP07adYkJycEr56BOUTNPzbInooiN3fn1qw==",
+      "dev": true,
+      "license": "Apache-2.0",
+      "bin": {
+        "tsc": "bin/tsc",
+        "tsserver": "bin/tsserver"
+      },
+      "engines": {
+        "node": ">=14.17"
+      }
+    }
+  }
+}
diff --git a/package.json b/package.json
new file mode 100644
index 0000000..6f33e13
--- /dev/null
+++ b/package.json
@@ -0,0 +1,6 @@
+{
+  "devDependencies": {
+    "@types/node": "^7.10.14",
+    "typescript": "^5.5.4"
+  }
+}
diff --git a/run.sh b/run.sh
index 2ca06f3..3a0745e 100644
--- a/run.sh
+++ b/run.sh
@@ -2,7 +2,7 @@ docker run --name synthclient \
 --env SECUREDNA_SYNTHCLIENT_TOKEN_FILE="/certs/token.st" \
 --env SECUREDNA_SYNTHCLIENT_KEYPAIR_FILE="/certs/token.priv" \
 --env SECUREDNA_SYNTHCLIENT_KEYPAIR_PASSPHRASE_FILE="/certs/token.passphrase" \
---volume /workspaces/sdna/:/certs/:z \
+--volume ./:/certs/:z \
 --detach \
 -p 80:80 \
 ghcr.io/securedna/synthclient \
diff --git a/simple_test.sh b/simple_test.sh
new file mode 100644
index 0000000..abc1f3e
--- /dev/null
+++ b/simple_test.sh
@@ -0,0 +1,10 @@
+curl "localhost:80/v1/screen" \
+--header "Content-Type: application/json" \
+--no-progress-meter \
+--data-raw '
+{
+"fasta": ">NC_007373.1\nGAATCGCAATTAACAATAACTAAAGAGAAAAAAGAAGAACTC",
+"region": "all",
+"provider_reference": "documentation"
+}
+' | jq
\ No newline at end of file
diff --git a/tsconfig.json b/tsconfig.json
new file mode 100644
index 0000000..98840de
--- /dev/null
+++ b/tsconfig.json
@@ -0,0 +1,9 @@
+{
+
+  "compilerOptions": {
+      "module": "commonjs",
+      /* List of folders to include type definitions from. */
+      "lib": ["es2017.object", "es2019.Array", "DOM"]
+  },
+
+}
\ No newline at end of file